ID: 987831296

View in Genome Browser
Species Human (GRCh38)
Location 5:23099134-23099156
Sequence TTAACTTTACATCAGCATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987831296_987831297 -1 Left 987831296 5:23099134-23099156 CCATAATGCTGATGTAAAGTTAA No data
Right 987831297 5:23099156-23099178 ATACATCATATGTTACATGTAGG No data
987831296_987831299 1 Left 987831296 5:23099134-23099156 CCATAATGCTGATGTAAAGTTAA No data
Right 987831299 5:23099158-23099180 ACATCATATGTTACATGTAGGGG No data
987831296_987831298 0 Left 987831296 5:23099134-23099156 CCATAATGCTGATGTAAAGTTAA No data
Right 987831298 5:23099157-23099179 TACATCATATGTTACATGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987831296 Original CRISPR TTAACTTTACATCAGCATTA TGG (reversed) Intergenic
No off target data available for this crispr