ID: 987831298

View in Genome Browser
Species Human (GRCh38)
Location 5:23099157-23099179
Sequence TACATCATATGTTACATGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987831296_987831298 0 Left 987831296 5:23099134-23099156 CCATAATGCTGATGTAAAGTTAA No data
Right 987831298 5:23099157-23099179 TACATCATATGTTACATGTAGGG No data
987831295_987831298 10 Left 987831295 5:23099124-23099146 CCAATGATATCCATAATGCTGAT No data
Right 987831298 5:23099157-23099179 TACATCATATGTTACATGTAGGG No data
987831294_987831298 30 Left 987831294 5:23099104-23099126 CCATAAAAATTGGGAACAAGCCA No data
Right 987831298 5:23099157-23099179 TACATCATATGTTACATGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987831298 Original CRISPR TACATCATATGTTACATGTA GGG Intergenic
No off target data available for this crispr