ID: 987838927

View in Genome Browser
Species Human (GRCh38)
Location 5:23197912-23197934
Sequence GAAGAAAGAATTCAACCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987838924_987838927 -3 Left 987838924 5:23197892-23197914 CCTCAATTCTTGTCTCCTCAGAA No data
Right 987838927 5:23197912-23197934 GAAGAAAGAATTCAACCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987838927 Original CRISPR GAAGAAAGAATTCAACCACA GGG Intergenic