ID: 987840478

View in Genome Browser
Species Human (GRCh38)
Location 5:23217177-23217199
Sequence AGGGGAGGAACTCCAAGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987840478_987840487 14 Left 987840478 5:23217177-23217199 CCTGTGCTTGGAGTTCCTCCCCT No data
Right 987840487 5:23217214-23217236 AGCTTTGGAGCTTAGGGAATTGG No data
987840478_987840486 8 Left 987840478 5:23217177-23217199 CCTGTGCTTGGAGTTCCTCCCCT No data
Right 987840486 5:23217208-23217230 ACTCGCAGCTTTGGAGCTTAGGG No data
987840478_987840485 7 Left 987840478 5:23217177-23217199 CCTGTGCTTGGAGTTCCTCCCCT No data
Right 987840485 5:23217207-23217229 AACTCGCAGCTTTGGAGCTTAGG No data
987840478_987840484 -1 Left 987840478 5:23217177-23217199 CCTGTGCTTGGAGTTCCTCCCCT No data
Right 987840484 5:23217199-23217221 TGGAATGCAACTCGCAGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987840478 Original CRISPR AGGGGAGGAACTCCAAGCAC AGG (reversed) Intergenic
No off target data available for this crispr