ID: 987840480

View in Genome Browser
Species Human (GRCh38)
Location 5:23217192-23217214
Sequence TGCGAGTTGCATTCCAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987840480_987840488 19 Left 987840480 5:23217192-23217214 CCTCCCCTGGAATGCAACTCGCA No data
Right 987840488 5:23217234-23217256 TGGCACCCATGTTAACTTTCTGG No data
987840480_987840486 -7 Left 987840480 5:23217192-23217214 CCTCCCCTGGAATGCAACTCGCA No data
Right 987840486 5:23217208-23217230 ACTCGCAGCTTTGGAGCTTAGGG No data
987840480_987840487 -1 Left 987840480 5:23217192-23217214 CCTCCCCTGGAATGCAACTCGCA No data
Right 987840487 5:23217214-23217236 AGCTTTGGAGCTTAGGGAATTGG No data
987840480_987840485 -8 Left 987840480 5:23217192-23217214 CCTCCCCTGGAATGCAACTCGCA No data
Right 987840485 5:23217207-23217229 AACTCGCAGCTTTGGAGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987840480 Original CRISPR TGCGAGTTGCATTCCAGGGG AGG (reversed) Intergenic