ID: 987840481

View in Genome Browser
Species Human (GRCh38)
Location 5:23217195-23217217
Sequence AGCTGCGAGTTGCATTCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987840481_987840487 -4 Left 987840481 5:23217195-23217217 CCCCTGGAATGCAACTCGCAGCT No data
Right 987840487 5:23217214-23217236 AGCTTTGGAGCTTAGGGAATTGG No data
987840481_987840488 16 Left 987840481 5:23217195-23217217 CCCCTGGAATGCAACTCGCAGCT No data
Right 987840488 5:23217234-23217256 TGGCACCCATGTTAACTTTCTGG No data
987840481_987840486 -10 Left 987840481 5:23217195-23217217 CCCCTGGAATGCAACTCGCAGCT No data
Right 987840486 5:23217208-23217230 ACTCGCAGCTTTGGAGCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987840481 Original CRISPR AGCTGCGAGTTGCATTCCAG GGG (reversed) Intergenic
No off target data available for this crispr