ID: 987840482

View in Genome Browser
Species Human (GRCh38)
Location 5:23217196-23217218
Sequence AAGCTGCGAGTTGCATTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987840482_987840487 -5 Left 987840482 5:23217196-23217218 CCCTGGAATGCAACTCGCAGCTT No data
Right 987840487 5:23217214-23217236 AGCTTTGGAGCTTAGGGAATTGG No data
987840482_987840488 15 Left 987840482 5:23217196-23217218 CCCTGGAATGCAACTCGCAGCTT No data
Right 987840488 5:23217234-23217256 TGGCACCCATGTTAACTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987840482 Original CRISPR AAGCTGCGAGTTGCATTCCA GGG (reversed) Intergenic