ID: 987840483

View in Genome Browser
Species Human (GRCh38)
Location 5:23217197-23217219
Sequence AAAGCTGCGAGTTGCATTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987840483_987840488 14 Left 987840483 5:23217197-23217219 CCTGGAATGCAACTCGCAGCTTT No data
Right 987840488 5:23217234-23217256 TGGCACCCATGTTAACTTTCTGG No data
987840483_987840487 -6 Left 987840483 5:23217197-23217219 CCTGGAATGCAACTCGCAGCTTT No data
Right 987840487 5:23217214-23217236 AGCTTTGGAGCTTAGGGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987840483 Original CRISPR AAAGCTGCGAGTTGCATTCC AGG (reversed) Intergenic
No off target data available for this crispr