ID: 987840487

View in Genome Browser
Species Human (GRCh38)
Location 5:23217214-23217236
Sequence AGCTTTGGAGCTTAGGGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987840481_987840487 -4 Left 987840481 5:23217195-23217217 CCCCTGGAATGCAACTCGCAGCT No data
Right 987840487 5:23217214-23217236 AGCTTTGGAGCTTAGGGAATTGG No data
987840483_987840487 -6 Left 987840483 5:23217197-23217219 CCTGGAATGCAACTCGCAGCTTT No data
Right 987840487 5:23217214-23217236 AGCTTTGGAGCTTAGGGAATTGG No data
987840478_987840487 14 Left 987840478 5:23217177-23217199 CCTGTGCTTGGAGTTCCTCCCCT No data
Right 987840487 5:23217214-23217236 AGCTTTGGAGCTTAGGGAATTGG No data
987840480_987840487 -1 Left 987840480 5:23217192-23217214 CCTCCCCTGGAATGCAACTCGCA No data
Right 987840487 5:23217214-23217236 AGCTTTGGAGCTTAGGGAATTGG No data
987840482_987840487 -5 Left 987840482 5:23217196-23217218 CCCTGGAATGCAACTCGCAGCTT No data
Right 987840487 5:23217214-23217236 AGCTTTGGAGCTTAGGGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987840487 Original CRISPR AGCTTTGGAGCTTAGGGAAT TGG Intergenic
No off target data available for this crispr