ID: 987840488

View in Genome Browser
Species Human (GRCh38)
Location 5:23217234-23217256
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987840480_987840488 19 Left 987840480 5:23217192-23217214 CCTCCCCTGGAATGCAACTCGCA No data
Right 987840488 5:23217234-23217256 TGGCACCCATGTTAACTTTCTGG No data
987840482_987840488 15 Left 987840482 5:23217196-23217218 CCCTGGAATGCAACTCGCAGCTT No data
Right 987840488 5:23217234-23217256 TGGCACCCATGTTAACTTTCTGG No data
987840481_987840488 16 Left 987840481 5:23217195-23217217 CCCCTGGAATGCAACTCGCAGCT No data
Right 987840488 5:23217234-23217256 TGGCACCCATGTTAACTTTCTGG No data
987840483_987840488 14 Left 987840483 5:23217197-23217219 CCTGGAATGCAACTCGCAGCTTT No data
Right 987840488 5:23217234-23217256 TGGCACCCATGTTAACTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type