ID: 987842271

View in Genome Browser
Species Human (GRCh38)
Location 5:23237098-23237120
Sequence GGTCAAACAGTACCAAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987842266_987842271 -2 Left 987842266 5:23237077-23237099 CCAGACTCCAAGGAGCACTGGGG No data
Right 987842271 5:23237098-23237120 GGTCAAACAGTACCAAAGGAGGG No data
987842268_987842271 -9 Left 987842268 5:23237084-23237106 CCAAGGAGCACTGGGGTCAAACA No data
Right 987842271 5:23237098-23237120 GGTCAAACAGTACCAAAGGAGGG No data
987842262_987842271 0 Left 987842262 5:23237075-23237097 CCCCAGACTCCAAGGAGCACTGG 0: 7
1: 12
2: 33
3: 65
4: 269
Right 987842271 5:23237098-23237120 GGTCAAACAGTACCAAAGGAGGG No data
987842264_987842271 -1 Left 987842264 5:23237076-23237098 CCCAGACTCCAAGGAGCACTGGG 0: 7
1: 12
2: 28
3: 77
4: 300
Right 987842271 5:23237098-23237120 GGTCAAACAGTACCAAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987842271 Original CRISPR GGTCAAACAGTACCAAAGGA GGG Intergenic
No off target data available for this crispr