ID: 987842668

View in Genome Browser
Species Human (GRCh38)
Location 5:23240491-23240513
Sequence CAGAGCAGGGAGAAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987842655_987842668 28 Left 987842655 5:23240440-23240462 CCCACCCTTCCTGTACCCTAACA No data
Right 987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG No data
987842660_987842668 13 Left 987842660 5:23240455-23240477 CCCTAACAGAAGAAGTTTTTGAC No data
Right 987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG No data
987842659_987842668 19 Left 987842659 5:23240449-23240471 CCTGTACCCTAACAGAAGAAGTT No data
Right 987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG No data
987842656_987842668 27 Left 987842656 5:23240441-23240463 CCACCCTTCCTGTACCCTAACAG No data
Right 987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG No data
987842658_987842668 23 Left 987842658 5:23240445-23240467 CCTTCCTGTACCCTAACAGAAGA No data
Right 987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG No data
987842657_987842668 24 Left 987842657 5:23240444-23240466 CCCTTCCTGTACCCTAACAGAAG No data
Right 987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG No data
987842662_987842668 -9 Left 987842662 5:23240477-23240499 CCCAATCAATAGAGCAGAGCAGG No data
Right 987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG No data
987842654_987842668 29 Left 987842654 5:23240439-23240461 CCCCACCCTTCCTGTACCCTAAC No data
Right 987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG No data
987842664_987842668 -10 Left 987842664 5:23240478-23240500 CCAATCAATAGAGCAGAGCAGGG No data
Right 987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG No data
987842661_987842668 12 Left 987842661 5:23240456-23240478 CCTAACAGAAGAAGTTTTTGACC No data
Right 987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987842668 Original CRISPR CAGAGCAGGGAGAAAGAGGA GGG Intergenic
No off target data available for this crispr