ID: 987844586

View in Genome Browser
Species Human (GRCh38)
Location 5:23266022-23266044
Sequence TACTGCCCATATCAATTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987844586_987844589 30 Left 987844586 5:23266022-23266044 CCTGATAATTGATATGGGCAGTA No data
Right 987844589 5:23266075-23266097 TTTTTATCTCACATGGAACATGG No data
987844586_987844587 3 Left 987844586 5:23266022-23266044 CCTGATAATTGATATGGGCAGTA No data
Right 987844587 5:23266048-23266070 GATAACAGTGTATGATAGAAAGG No data
987844586_987844588 23 Left 987844586 5:23266022-23266044 CCTGATAATTGATATGGGCAGTA No data
Right 987844588 5:23266068-23266090 AGGAAAATTTTTATCTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987844586 Original CRISPR TACTGCCCATATCAATTATC AGG (reversed) Intergenic
No off target data available for this crispr