ID: 987844589

View in Genome Browser
Species Human (GRCh38)
Location 5:23266075-23266097
Sequence TTTTTATCTCACATGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987844586_987844589 30 Left 987844586 5:23266022-23266044 CCTGATAATTGATATGGGCAGTA No data
Right 987844589 5:23266075-23266097 TTTTTATCTCACATGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987844589 Original CRISPR TTTTTATCTCACATGGAACA TGG Intergenic
No off target data available for this crispr