ID: 987844589 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:23266075-23266097 |
| Sequence | TTTTTATCTCACATGGAACA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 987844586_987844589 | 30 | Left | 987844586 | 5:23266022-23266044 | CCTGATAATTGATATGGGCAGTA | No data | ||
| Right | 987844589 | 5:23266075-23266097 | TTTTTATCTCACATGGAACATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 987844589 | Original CRISPR | TTTTTATCTCACATGGAACA TGG | Intergenic | ||
| No off target data available for this crispr | |||||