ID: 987846542

View in Genome Browser
Species Human (GRCh38)
Location 5:23294748-23294770
Sequence CCTACTAGGTAGAAGGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987846542_987846551 26 Left 987846542 5:23294748-23294770 CCCAACCCCTTCTACCTAGTAGG No data
Right 987846551 5:23294797-23294819 TCTGTCAGGTTATCTTTTATAGG No data
987846542_987846550 12 Left 987846542 5:23294748-23294770 CCCAACCCCTTCTACCTAGTAGG No data
Right 987846550 5:23294783-23294805 AAATCTGCTGTTAATCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987846542 Original CRISPR CCTACTAGGTAGAAGGGGTT GGG (reversed) Intergenic
No off target data available for this crispr