ID: 987846733

View in Genome Browser
Species Human (GRCh38)
Location 5:23296300-23296322
Sequence ACTCTTAGGGGACCACAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987846733_987846741 11 Left 987846733 5:23296300-23296322 CCCACTTGTGGTCCCCTAAGAGT No data
Right 987846741 5:23296334-23296356 TTCCAGGCAACTGCTGACTAGGG No data
987846733_987846740 10 Left 987846733 5:23296300-23296322 CCCACTTGTGGTCCCCTAAGAGT No data
Right 987846740 5:23296333-23296355 TTTCCAGGCAACTGCTGACTAGG No data
987846733_987846738 -5 Left 987846733 5:23296300-23296322 CCCACTTGTGGTCCCCTAAGAGT No data
Right 987846738 5:23296318-23296340 AGAGTACCATGTCTATTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987846733 Original CRISPR ACTCTTAGGGGACCACAAGT GGG (reversed) Intergenic
No off target data available for this crispr