ID: 987849068

View in Genome Browser
Species Human (GRCh38)
Location 5:23325434-23325456
Sequence CTTTGGGTTTCTAGAGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987849068_987849072 7 Left 987849068 5:23325434-23325456 CCTTATTCTCTAGAAACCCAAAG No data
Right 987849072 5:23325464-23325486 CAGAATAAAGAGAAAGCCTGAGG No data
987849068_987849073 21 Left 987849068 5:23325434-23325456 CCTTATTCTCTAGAAACCCAAAG No data
Right 987849073 5:23325478-23325500 AGCCTGAGGCTTTGAATAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987849068 Original CRISPR CTTTGGGTTTCTAGAGAATA AGG (reversed) Intergenic
No off target data available for this crispr