ID: 987852838

View in Genome Browser
Species Human (GRCh38)
Location 5:23379321-23379343
Sequence TTTTCCATCTAGTAAAGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987852838_987852844 17 Left 987852838 5:23379321-23379343 CCATCCCTTTACTAGATGGAAAA No data
Right 987852844 5:23379361-23379383 ACTGCCTGCTTCCAAAGGAGAGG No data
987852838_987852843 12 Left 987852838 5:23379321-23379343 CCATCCCTTTACTAGATGGAAAA No data
Right 987852843 5:23379356-23379378 GATCTACTGCCTGCTTCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987852838 Original CRISPR TTTTCCATCTAGTAAAGGGA TGG (reversed) Intergenic
No off target data available for this crispr