ID: 987853855

View in Genome Browser
Species Human (GRCh38)
Location 5:23392414-23392436
Sequence CTTGGTTATAACCAATGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987853852_987853855 27 Left 987853852 5:23392364-23392386 CCTACTATTGAAAAGTACAATTC No data
Right 987853855 5:23392414-23392436 CTTGGTTATAACCAATGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987853855 Original CRISPR CTTGGTTATAACCAATGCAA GGG Intergenic
No off target data available for this crispr