ID: 987855123

View in Genome Browser
Species Human (GRCh38)
Location 5:23411299-23411321
Sequence CGGCGATCAGCAGTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987855123_987855132 24 Left 987855123 5:23411299-23411321 CCGTCCACCACTGCTGATCGCCG No data
Right 987855132 5:23411346-23411368 CCACCCCTCCGGATCCAGCAGGG 0: 17
1: 68
2: 120
3: 148
4: 241
987855123_987855130 23 Left 987855123 5:23411299-23411321 CCGTCCACCACTGCTGATCGCCG No data
Right 987855130 5:23411345-23411367 TCCACCCCTCCGGATCCAGCAGG 0: 17
1: 53
2: 127
3: 140
4: 211
987855123_987855129 13 Left 987855123 5:23411299-23411321 CCGTCCACCACTGCTGATCGCCG No data
Right 987855129 5:23411335-23411357 ATCACTGACTTCCACCCCTCCGG 0: 3
1: 9
2: 37
3: 111
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987855123 Original CRISPR CGGCGATCAGCAGTGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr