ID: 987857216

View in Genome Browser
Species Human (GRCh38)
Location 5:23436260-23436282
Sequence TCACAGTAAGTGCCCTGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987857215_987857216 -9 Left 987857215 5:23436246-23436268 CCTGCAAGCTACATTCACAGTAA No data
Right 987857216 5:23436260-23436282 TCACAGTAAGTGCCCTGTACAGG No data
987857213_987857216 28 Left 987857213 5:23436209-23436231 CCACTCTCTTATGCACTAAACTA No data
Right 987857216 5:23436260-23436282 TCACAGTAAGTGCCCTGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987857216 Original CRISPR TCACAGTAAGTGCCCTGTAC AGG Intergenic
No off target data available for this crispr