ID: 987860411

View in Genome Browser
Species Human (GRCh38)
Location 5:23479554-23479576
Sequence TACAAGAATACTGGAGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987860411_987860415 -5 Left 987860411 5:23479554-23479576 CCACCTTCTCCAGTATTCTTGTA No data
Right 987860415 5:23479572-23479594 TTGTATTTCACTTCTACATTGGG No data
987860411_987860414 -6 Left 987860411 5:23479554-23479576 CCACCTTCTCCAGTATTCTTGTA No data
Right 987860414 5:23479571-23479593 CTTGTATTTCACTTCTACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987860411 Original CRISPR TACAAGAATACTGGAGAAGG TGG (reversed) Intergenic
No off target data available for this crispr