ID: 987860412

View in Genome Browser
Species Human (GRCh38)
Location 5:23479557-23479579
Sequence AAATACAAGAATACTGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987860412_987860415 -8 Left 987860412 5:23479557-23479579 CCTTCTCCAGTATTCTTGTATTT No data
Right 987860415 5:23479572-23479594 TTGTATTTCACTTCTACATTGGG No data
987860412_987860414 -9 Left 987860412 5:23479557-23479579 CCTTCTCCAGTATTCTTGTATTT No data
Right 987860414 5:23479571-23479593 CTTGTATTTCACTTCTACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987860412 Original CRISPR AAATACAAGAATACTGGAGA AGG (reversed) Intergenic
No off target data available for this crispr