ID: 987860414

View in Genome Browser
Species Human (GRCh38)
Location 5:23479571-23479593
Sequence CTTGTATTTCACTTCTACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987860412_987860414 -9 Left 987860412 5:23479557-23479579 CCTTCTCCAGTATTCTTGTATTT No data
Right 987860414 5:23479571-23479593 CTTGTATTTCACTTCTACATTGG No data
987860411_987860414 -6 Left 987860411 5:23479554-23479576 CCACCTTCTCCAGTATTCTTGTA No data
Right 987860414 5:23479571-23479593 CTTGTATTTCACTTCTACATTGG No data
987860409_987860414 17 Left 987860409 5:23479531-23479553 CCTACAAGGCTCCACACATTCTT No data
Right 987860414 5:23479571-23479593 CTTGTATTTCACTTCTACATTGG No data
987860410_987860414 6 Left 987860410 5:23479542-23479564 CCACACATTCTTCCACCTTCTCC No data
Right 987860414 5:23479571-23479593 CTTGTATTTCACTTCTACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987860414 Original CRISPR CTTGTATTTCACTTCTACAT TGG Intergenic
No off target data available for this crispr