ID: 987862508

View in Genome Browser
Species Human (GRCh38)
Location 5:23506317-23506339
Sequence CTGCAAGGAGATACGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987862508_987862517 22 Left 987862508 5:23506317-23506339 CCAGGCTCCGTATCTCCTTGCAG No data
Right 987862517 5:23506362-23506384 TCTGACCCAGGAGACAGCAGGGG No data
987862508_987862513 10 Left 987862508 5:23506317-23506339 CCAGGCTCCGTATCTCCTTGCAG No data
Right 987862513 5:23506350-23506372 CATTAGCTGACCTCTGACCCAGG No data
987862508_987862516 21 Left 987862508 5:23506317-23506339 CCAGGCTCCGTATCTCCTTGCAG No data
Right 987862516 5:23506361-23506383 CTCTGACCCAGGAGACAGCAGGG No data
987862508_987862515 20 Left 987862508 5:23506317-23506339 CCAGGCTCCGTATCTCCTTGCAG No data
Right 987862515 5:23506360-23506382 CCTCTGACCCAGGAGACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987862508 Original CRISPR CTGCAAGGAGATACGGAGCC TGG (reversed) Intergenic
No off target data available for this crispr