ID: 987866042

View in Genome Browser
Species Human (GRCh38)
Location 5:23540560-23540582
Sequence GATGACTTTGGAACACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987866042_987866046 22 Left 987866042 5:23540560-23540582 CCTGTCTGTGTTCCAAAGTCATC No data
Right 987866046 5:23540605-23540627 AGTTCTCATTTGGCTTTTTATGG No data
987866042_987866044 12 Left 987866042 5:23540560-23540582 CCTGTCTGTGTTCCAAAGTCATC No data
Right 987866044 5:23540595-23540617 TCCATTTTCGAGTTCTCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987866042 Original CRISPR GATGACTTTGGAACACAGAC AGG (reversed) Intergenic
No off target data available for this crispr