ID: 987866575

View in Genome Browser
Species Human (GRCh38)
Location 5:23547864-23547886
Sequence CCCTTTTATTCTGGCTTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987866569_987866575 -10 Left 987866569 5:23547851-23547873 CCAAAAAAGGCCCCCCTTTTATT No data
Right 987866575 5:23547864-23547886 CCCTTTTATTCTGGCTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987866575 Original CRISPR CCCTTTTATTCTGGCTTCTG TGG Intergenic
No off target data available for this crispr