ID: 987871255

View in Genome Browser
Species Human (GRCh38)
Location 5:23620486-23620508
Sequence GGTAATCGAAGTACAGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987871252_987871255 16 Left 987871252 5:23620447-23620469 CCAAATAAATTGACTAGATCCGC No data
Right 987871255 5:23620486-23620508 GGTAATCGAAGTACAGATATTGG No data
987871254_987871255 -3 Left 987871254 5:23620466-23620488 CCGCAAAGAGTTGAACTTGAGGT No data
Right 987871255 5:23620486-23620508 GGTAATCGAAGTACAGATATTGG No data
987871251_987871255 27 Left 987871251 5:23620436-23620458 CCATCACAAGGCCAAATAAATTG No data
Right 987871255 5:23620486-23620508 GGTAATCGAAGTACAGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987871255 Original CRISPR GGTAATCGAAGTACAGATAT TGG Intergenic
No off target data available for this crispr