ID: 987871339

View in Genome Browser
Species Human (GRCh38)
Location 5:23621886-23621908
Sequence GGGTTTGTACCAGTGTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987871335_987871339 5 Left 987871335 5:23621858-23621880 CCAAAAACATTTTAGAATCTCTG No data
Right 987871339 5:23621886-23621908 GGGTTTGTACCAGTGTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987871339 Original CRISPR GGGTTTGTACCAGTGTCCTC AGG Intergenic
No off target data available for this crispr