ID: 987876028

View in Genome Browser
Species Human (GRCh38)
Location 5:23682022-23682044
Sequence CAGAAGAAGAATATGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987876028_987876031 15 Left 987876028 5:23682022-23682044 CCTGCCTCCATATTCTTCTTCTG No data
Right 987876031 5:23682060-23682082 TGCTTGCTATTTGCTTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987876028 Original CRISPR CAGAAGAAGAATATGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr