ID: 987876031

View in Genome Browser
Species Human (GRCh38)
Location 5:23682060-23682082
Sequence TGCTTGCTATTTGCTTTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987876029_987876031 11 Left 987876029 5:23682026-23682048 CCTCCATATTCTTCTTCTGATTC No data
Right 987876031 5:23682060-23682082 TGCTTGCTATTTGCTTTCAGAGG No data
987876028_987876031 15 Left 987876028 5:23682022-23682044 CCTGCCTCCATATTCTTCTTCTG No data
Right 987876031 5:23682060-23682082 TGCTTGCTATTTGCTTTCAGAGG No data
987876030_987876031 8 Left 987876030 5:23682029-23682051 CCATATTCTTCTTCTGATTCTAC No data
Right 987876031 5:23682060-23682082 TGCTTGCTATTTGCTTTCAGAGG No data
987876027_987876031 18 Left 987876027 5:23682019-23682041 CCTCCTGCCTCCATATTCTTCTT No data
Right 987876031 5:23682060-23682082 TGCTTGCTATTTGCTTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987876031 Original CRISPR TGCTTGCTATTTGCTTTCAG AGG Intergenic
No off target data available for this crispr