ID: 987876924

View in Genome Browser
Species Human (GRCh38)
Location 5:23691170-23691192
Sequence CGTCCACCCAGAACTCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987876924_987876930 2 Left 987876924 5:23691170-23691192 CCAGCTGGAGTTCTGGGTGGACG No data
Right 987876930 5:23691195-23691217 GGTTTGGTGGGCCCCGCACTCGG No data
987876924_987876934 24 Left 987876924 5:23691170-23691192 CCAGCTGGAGTTCTGGGTGGACG No data
Right 987876934 5:23691217-23691239 GAGCAGCCAGCCAGCCCTGCTGG 0: 105
1: 170
2: 259
3: 274
4: 581
987876924_987876936 30 Left 987876924 5:23691170-23691192 CCAGCTGGAGTTCTGGGTGGACG No data
Right 987876936 5:23691223-23691245 CCAGCCAGCCCTGCTGGCCCCGG 0: 102
1: 98
2: 138
3: 330
4: 982
987876924_987876929 -10 Left 987876924 5:23691170-23691192 CCAGCTGGAGTTCTGGGTGGACG No data
Right 987876929 5:23691183-23691205 TGGGTGGACGTGGGTTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987876924 Original CRISPR CGTCCACCCAGAACTCCAGC TGG (reversed) Intergenic
No off target data available for this crispr