ID: 987877720

View in Genome Browser
Species Human (GRCh38)
Location 5:23700755-23700777
Sequence CTGGTAAAACATATTTTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987877716_987877720 27 Left 987877716 5:23700705-23700727 CCCTGGATTTCTTAGAATATTTA No data
Right 987877720 5:23700755-23700777 CTGGTAAAACATATTTTACAAGG No data
987877717_987877720 26 Left 987877717 5:23700706-23700728 CCTGGATTTCTTAGAATATTTAT No data
Right 987877720 5:23700755-23700777 CTGGTAAAACATATTTTACAAGG No data
987877718_987877720 2 Left 987877718 5:23700730-23700752 CCTACTTCACAATACTATTTTAT No data
Right 987877720 5:23700755-23700777 CTGGTAAAACATATTTTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987877720 Original CRISPR CTGGTAAAACATATTTTACA AGG Intergenic
No off target data available for this crispr