ID: 987881156

View in Genome Browser
Species Human (GRCh38)
Location 5:23748289-23748311
Sequence ACCACAAAGAAACAACATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987881154_987881156 -2 Left 987881154 5:23748268-23748290 CCAGGTAGAAGGTCAAAATTAAC No data
Right 987881156 5:23748289-23748311 ACCACAAAGAAACAACATTAGGG No data
987881151_987881156 23 Left 987881151 5:23748243-23748265 CCTGAATGACAAATCATAAAAAT No data
Right 987881156 5:23748289-23748311 ACCACAAAGAAACAACATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987881156 Original CRISPR ACCACAAAGAAACAACATTA GGG Intergenic
No off target data available for this crispr