ID: 987883383

View in Genome Browser
Species Human (GRCh38)
Location 5:23779612-23779634
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987883381_987883383 -5 Left 987883381 5:23779594-23779616 CCAATTCTGATTCAGGTTTGTTA No data
Right 987883383 5:23779612-23779634 TGTTAAATGTTGAAAGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr