ID: 987886184

View in Genome Browser
Species Human (GRCh38)
Location 5:23815904-23815926
Sequence AGGGAGAGTAAAGTGAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987886172_987886184 26 Left 987886172 5:23815855-23815877 CCTACACTGTGTCAGTGCCTGGT No data
Right 987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG No data
987886176_987886184 9 Left 987886176 5:23815872-23815894 CCTGGTGGGGAGAGAATCTGTGT No data
Right 987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987886184 Original CRISPR AGGGAGAGTAAAGTGAGTGT GGG Intergenic
No off target data available for this crispr