ID: 987886781

View in Genome Browser
Species Human (GRCh38)
Location 5:23823564-23823586
Sequence GAGTCTCCCTGAGCTCTTTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987886781_987886783 3 Left 987886781 5:23823564-23823586 CCGAAAAGAGCTCAGGGAGACTC No data
Right 987886783 5:23823590-23823612 TCAAATCATGCACATTCCCCGGG No data
987886781_987886782 2 Left 987886781 5:23823564-23823586 CCGAAAAGAGCTCAGGGAGACTC No data
Right 987886782 5:23823589-23823611 TTCAAATCATGCACATTCCCCGG No data
987886781_987886784 15 Left 987886781 5:23823564-23823586 CCGAAAAGAGCTCAGGGAGACTC No data
Right 987886784 5:23823602-23823624 CATTCCCCGGGTTTTAAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987886781 Original CRISPR GAGTCTCCCTGAGCTCTTTT CGG (reversed) Intergenic
No off target data available for this crispr