ID: 987888287

View in Genome Browser
Species Human (GRCh38)
Location 5:23840515-23840537
Sequence TTGTATATACATAAAGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987888285_987888287 9 Left 987888285 5:23840483-23840505 CCTTTAGGACTGCAATTTGCACA No data
Right 987888287 5:23840515-23840537 TTGTATATACATAAAGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987888287 Original CRISPR TTGTATATACATAAAGTGTC AGG Intergenic
No off target data available for this crispr