ID: 987899948

View in Genome Browser
Species Human (GRCh38)
Location 5:23998483-23998505
Sequence ACATTGGAAATCATGGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 230}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987899948_987899951 0 Left 987899948 5:23998483-23998505 CCTTGATCCATGATTTCCAATGT 0: 1
1: 0
2: 2
3: 13
4: 230
Right 987899951 5:23998506-23998528 CTGCATTCAAACTTGTAAAACGG 0: 1
1: 0
2: 3
3: 15
4: 271
987899948_987899952 10 Left 987899948 5:23998483-23998505 CCTTGATCCATGATTTCCAATGT 0: 1
1: 0
2: 2
3: 13
4: 230
Right 987899952 5:23998516-23998538 ACTTGTAAAACGGTGCTGCTTGG 0: 1
1: 0
2: 0
3: 2
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987899948 Original CRISPR ACATTGGAAATCATGGATCA AGG (reversed) Intronic
900850139 1:5136279-5136301 AATTTGGAAATCATTTATCAAGG - Intergenic
904061864 1:27717680-27717702 ATATTGGCAATCAGGGTTCAGGG - Intergenic
904148415 1:28414803-28414825 ACATTGAAGATCATGGAGTAGGG + Intronic
904788703 1:33001575-33001597 GCAGTGGAAAACATAGATCAGGG - Intergenic
906666663 1:47626960-47626982 ACCTTGGAGCTCATAGATCAGGG + Intergenic
909128758 1:71708651-71708673 ACATAGGTAAACATGTATCATGG + Intronic
909463810 1:75949807-75949829 ACATTGGGAATAATGGTTCACGG - Intergenic
915692847 1:157707409-157707431 ACATAGGTAAACATGCATCATGG - Intergenic
917160374 1:172050712-172050734 AAACTGGAAATCATAGATGAAGG + Intronic
918878876 1:190087388-190087410 ACCTTGAAAATCATGTTTCAAGG - Intergenic
920433234 1:205932191-205932213 ACCTTGAAAAGCATAGATCATGG - Intronic
920442159 1:205988634-205988656 ATAATGGAAATAATGGAACAAGG - Intronic
921998287 1:221445939-221445961 ACACTGGAAACTATAGATCATGG + Intergenic
922137889 1:222850487-222850509 ACATAGGTAAACATGTATCATGG + Intergenic
922320918 1:224485929-224485951 ACATTAGAAATCATGCAGTAGGG + Intronic
924137684 1:240987493-240987515 ACATCAAAAATCATGGATTAAGG - Intronic
1063060833 10:2550627-2550649 ACATAGGTAAACATGGGTCATGG - Intergenic
1065457766 10:25925550-25925572 ACATTGGACATCATAGCTCCTGG + Intergenic
1066207693 10:33205842-33205864 AAATTGGAAATTATGGTTTAGGG - Intronic
1068327796 10:55517417-55517439 ACTTTGGAGCTCATGGGTCACGG - Intronic
1068949301 10:62761421-62761443 AGAGTGGAAGGCATGGATCAGGG + Intergenic
1075975762 10:126692643-126692665 AGATTAGAAATTATGGTTCAGGG - Intergenic
1075985365 10:126780383-126780405 ACATTGGAAGAAAGGGATCAAGG - Intergenic
1079348442 11:19672787-19672809 ACAGTGGGAATCAGGGGTCAGGG + Intronic
1079616822 11:22505328-22505350 ACATTGGTAAACATGTGTCATGG + Intergenic
1080078952 11:28190830-28190852 ACATTTGTAATCATGGAATAAGG + Intronic
1081658213 11:44871727-44871749 ACATTGGGAAGAATGGATGAAGG - Intronic
1084018629 11:66403274-66403296 ACATTGGTCATAATGGATTAGGG - Intergenic
1084503894 11:69553439-69553461 ACATTGGAAGCCATGGCCCAGGG - Intergenic
1087419409 11:97901524-97901546 ACATTGGAAATCATAAATAAGGG + Intergenic
1087942293 11:104112974-104112996 ACATAGGTAAACATGTATCATGG - Intronic
1088772515 11:113049383-113049405 CCTTTGAAACTCATGGATCAAGG + Intronic
1089678190 11:120104615-120104637 ACATAGGAAACCTTGGTTCAGGG - Intergenic
1091169701 11:133509118-133509140 ACATTGGTAAACGTGTATCATGG + Intronic
1091270235 11:134305679-134305701 AAAATGGAAATCAGGGAACATGG + Intronic
1092643954 12:10549509-10549531 GCATTGGAAAACTTGAATCATGG - Intergenic
1093412079 12:18879190-18879212 ACACTGGAAATCCAAGATCAAGG + Intergenic
1093864421 12:24207859-24207881 ACATTGGAGATTCTGGAACATGG - Intergenic
1095408453 12:41894375-41894397 ACACTGGAAATCGTGGGACAAGG - Intergenic
1096934271 12:55254117-55254139 TCAGTGGACATGATGGATCATGG - Intergenic
1097801782 12:63922278-63922300 AGATTAGAAATCATGTATCTTGG - Intronic
1098643183 12:72863498-72863520 ACATTGGAAATAATCCATTATGG - Intergenic
1098843219 12:75502897-75502919 ACAATGGAAGTTTTGGATCATGG - Exonic
1099219293 12:79893240-79893262 ACATTGGAAATAAAGGCTTAAGG - Intronic
1100016097 12:90012540-90012562 GTATTAGAAATCATGGATGAGGG - Intergenic
1101084950 12:101226222-101226244 ACAGTGGCAATCACGGTTCACGG - Intergenic
1101463580 12:104923703-104923725 AAATTGGAAAACATGCAACAAGG + Intronic
1102666485 12:114578324-114578346 ACATTGGAACTCTTGGTTCTTGG + Intergenic
1102723810 12:115040746-115040768 AACATGGAAATCATTGATCATGG + Intergenic
1107347939 13:39482956-39482978 ACATTGCAAAGGATGGATAAAGG + Intronic
1108451034 13:50563092-50563114 AGATTGGAAATCAAAGATCAAGG + Intronic
1112581086 13:100676525-100676547 ACATTATGAATCATGAATCAGGG + Intergenic
1112725411 13:102298251-102298273 AAATTAGAAATCATAGATCGTGG + Intronic
1113880516 13:113623004-113623026 ACATTGGGAATCAAGCTTCATGG + Intronic
1115413254 14:33100716-33100738 ACACTGTAAAACATAGATCAGGG - Intronic
1116105327 14:40495341-40495363 ACATTGGAGCTCCTGGTTCATGG + Intergenic
1117091820 14:52258760-52258782 ACATTGGAACTCTTGGTTCTTGG - Intergenic
1117508798 14:56428238-56428260 AGATTGGAAATCCAAGATCAAGG - Intergenic
1118490777 14:66257629-66257651 ACATTGGTATACATGGACCATGG + Intergenic
1118761586 14:68883469-68883491 ACATTAAAAATCAAGGTTCATGG + Intronic
1120290858 14:82569034-82569056 ATATGGGAAAGCAAGGATCATGG - Intergenic
1120463853 14:84830789-84830811 CCAGTTGAAATCATGGATCTTGG - Intergenic
1120703238 14:87721818-87721840 GCATTGGAATTCAATGATCAAGG - Intergenic
1121022486 14:90589212-90589234 ACAGTGGAAGTGATGGATGAAGG - Intronic
1121262874 14:92579226-92579248 AGATTAGAAATTATGGCTCAGGG - Intronic
1121621767 14:95355047-95355069 ACATTGGAGATTATGAAACATGG + Intergenic
1122358559 14:101141169-101141191 ACATAGGTAATCATGTACCATGG + Intergenic
1125073460 15:35584201-35584223 ACATAGAAAATCATGGATCATGG + Intergenic
1126188845 15:45857977-45857999 CCATTGGAAAACATAGATCCTGG - Intergenic
1127110770 15:55667014-55667036 ACATTGTAAATGATGTACCATGG + Intronic
1127907016 15:63383312-63383334 ACATTAGAAATTATGGTTTAGGG - Intergenic
1129912096 15:79236362-79236384 ACATGGGAGTTCATGGAGCAAGG - Intergenic
1130422966 15:83766792-83766814 ACATTAGAAATTATAGATGATGG + Intronic
1131368629 15:91861274-91861296 TCACTGGAACTCATGGATGAAGG - Intronic
1134740579 16:16540203-16540225 AGATTGGAAATTATGGTTTAGGG + Intergenic
1134926923 16:18171969-18171991 AGATTGGAAATTATGGTTTAGGG - Intergenic
1136990802 16:35150381-35150403 ATATTGGAAATGAAGGAGCAGGG - Intergenic
1138367616 16:56494266-56494288 ACATTGAAAATCATGGCTTCAGG - Intronic
1138849592 16:60610920-60610942 ACATTGTAAATTATGGCTCAGGG - Intergenic
1138978318 16:62236113-62236135 AAAGTGGAATTCATGGCTCATGG - Intergenic
1139199055 16:64954086-64954108 CCAATGGAAAACATGGATCTGGG + Intronic
1139930563 16:70523102-70523124 AAACTGGTGATCATGGATCAGGG + Intronic
1141689124 16:85586654-85586676 ACATGGGAAGCCATGGAGCACGG - Intergenic
1142315738 16:89343901-89343923 ACGTTGGAAACTACGGATCACGG + Intronic
1143834142 17:9676670-9676692 ACATTGTTGATAATGGATCAAGG - Intronic
1149121339 17:53169816-53169838 ACCTTGGAAATAATGCAGCAAGG - Intergenic
1153936232 18:9926520-9926542 ACAGTGGACATCATTGTTCATGG + Intronic
1154205825 18:12335809-12335831 ACACTGGAAAGCATGCAGCAGGG - Intronic
1156567476 18:38209898-38209920 ACATTGGAAATCAAGAATGAGGG + Intergenic
1159171362 18:64772384-64772406 ACAATGCAAATCATAGAGCATGG - Intergenic
1159537639 18:69735591-69735613 ACCTTGGACATCAAGGCTCAGGG - Intronic
1159578120 18:70204744-70204766 ACATTGGTATTTATGAATCACGG + Intronic
1159674773 18:71268868-71268890 TCATTCTGAATCATGGATCAGGG + Intergenic
1161161528 19:2764368-2764390 ACATAGAAAATCAGGTATCATGG - Intronic
1168305038 19:55430584-55430606 ACACTGGACCTCATGGATCCTGG + Exonic
1168305051 19:55430653-55430675 ACACTGGACCTCATGGATCCTGG + Exonic
1168305065 19:55430722-55430744 GCACTGGACCTCATGGATCACGG + Exonic
925222806 2:2155874-2155896 ACACAGCAAATCATGGAACATGG - Intronic
925840071 2:7983333-7983355 AAAGTGGAATTGATGGATCATGG - Intergenic
927075735 2:19575099-19575121 ACAGTGGAAATGATGGGCCAAGG + Intergenic
927516859 2:23676856-23676878 AGTTTGGAAATAAGGGATCAAGG + Intronic
927692494 2:25218161-25218183 ACATTGAAAAGAATGAATCAAGG - Intergenic
928121362 2:28586104-28586126 CCATGGGCAAACATGGATCATGG + Intronic
931141789 2:59467507-59467529 ACTCTGCAACTCATGGATCAAGG - Intergenic
933530793 2:83508950-83508972 CCATTTGAAATCATGAATCGAGG - Intergenic
936964234 2:118111652-118111674 ACATTGGAAATGAAGAATGAGGG + Intergenic
937177773 2:119958345-119958367 ACAATGAAAATAATGGATGAAGG + Intronic
937656891 2:124387057-124387079 ACATTGGCAATCTGAGATCAGGG - Intronic
939431411 2:142113760-142113782 TCATTGGGAATTCTGGATCATGG + Intronic
939870361 2:147519935-147519957 ACCTGGGAAATCTTGGAGCATGG - Intergenic
942141396 2:172980695-172980717 AAATTTGACATCATGGTTCAAGG - Intronic
942893895 2:181026534-181026556 CCTTTGGAAAGCATGTATCAAGG - Intronic
943976699 2:194488770-194488792 ACATTGGTAAACTTGGGTCATGG - Intergenic
944298144 2:198091384-198091406 ACATTTAAAAACATAGATCAAGG + Intronic
945118583 2:206434959-206434981 ACATTTGAAATCATGGTTCTTGG - Intergenic
946350044 2:219144564-219144586 ACATTGGACATTCTAGATCATGG + Intronic
948077597 2:235177901-235177923 ACAAAGGAAATCATGCAACACGG - Intergenic
1168861040 20:1046286-1046308 AAATTGAAAATCATGGACCCGGG + Intergenic
1171370437 20:24658796-24658818 ACACTGGACAGCATGGATCTGGG - Intronic
1173077633 20:39834831-39834853 ATATTGGAAAATATGGCTCATGG - Intergenic
1177298517 21:19209109-19209131 ACATTGGAGATCTTAGTTCAGGG - Intergenic
1178055207 21:28791064-28791086 ACATAGAAAATGATGGATTAGGG + Intergenic
1179204463 21:39261532-39261554 ACATTTGTACTGATGGATCATGG - Intronic
1183067770 22:35375325-35375347 AGATGGGAAGTCATGGATCCTGG + Intergenic
1183593439 22:38795191-38795213 ACATTAGAAATTATGGTTTAGGG + Intergenic
949500786 3:4678353-4678375 ACTTTGGAACACATGGACCATGG - Intronic
949993603 3:9599699-9599721 AGATTGGAAATTATGGTTTAAGG - Intergenic
950095473 3:10327003-10327025 GCATGGGACATCATCGATCATGG + Exonic
950745853 3:15088116-15088138 ACATTGGCAATCATGAAACAAGG + Intronic
951512928 3:23524582-23524604 ACAATACAACTCATGGATCATGG + Intronic
951577013 3:24124168-24124190 TCATTGGAAAGGAAGGATCAGGG + Intronic
951683580 3:25320521-25320543 ATGTTGGAAATCCTGGGTCAGGG - Intronic
953088754 3:39702021-39702043 AAATTGCAAATCATTGATGAAGG - Intergenic
953226304 3:41024854-41024876 ACATTGGAATTCATGGAACTTGG - Intergenic
953444062 3:42947446-42947468 ACATTGCAGATGATGGATGATGG + Intronic
953706217 3:45232778-45232800 ACATTGGAACACATTTATCATGG + Intergenic
954554602 3:51507958-51507980 AATTTGAAAATCATGGATCTAGG - Intergenic
956140636 3:66143181-66143203 ACAATGGATATAATGGATAATGG - Intronic
956639167 3:71398755-71398777 AGATAGGAAATCATGCATTATGG + Intronic
956692502 3:71891078-71891100 TCATTGGGAATCTTGGTTCAGGG + Intergenic
959660006 3:108857277-108857299 ACCTAGGAAGTCATGCATCAAGG + Intergenic
960475193 3:118116122-118116144 ACATAGGTAAACATGGGTCATGG - Intergenic
961329344 3:126129525-126129547 TCAGTGCAGATCATGGATCAGGG + Intronic
962042763 3:131724378-131724400 ACAAAGGAAATCATAGCTCATGG - Intronic
963504317 3:146164536-146164558 AAGTTAGAAATCATGGAACAGGG - Intergenic
964886140 3:161485182-161485204 CCATTTAGAATCATGGATCAAGG - Intergenic
966130996 3:176639695-176639717 ACATAGGAAAACATGTGTCATGG + Intergenic
967365985 3:188687125-188687147 AAATTGGAAATGAGGGAGCATGG - Intronic
967405050 3:189105987-189106009 ACATAGGTAAACATGTATCATGG - Intronic
968538667 4:1151117-1151139 ACATTGGCAGTCATGGGTAAAGG + Intergenic
970045749 4:11851147-11851169 ACATTGGTAAACTTGGGTCATGG - Intergenic
970914080 4:21311935-21311957 ACATTGTGATTCATAGATCATGG - Intronic
971016716 4:22496587-22496609 ACTTTGGAAATTATGACTCAAGG + Intronic
972331917 4:38071899-38071921 ACAGTGCAAATCATGGCTCCTGG - Intronic
974281700 4:59803557-59803579 ACATTGGTCATAATGGATTATGG + Intergenic
976129939 4:81872823-81872845 AGACTGGAAATCTGGGATCAGGG - Intronic
976515902 4:85966030-85966052 AAATTGGAAATCTAAGATCAGGG + Intronic
980012020 4:127606931-127606953 ACAATGGAAAGCATAAATCAAGG + Intergenic
980526675 4:133997448-133997470 ATTCTGCAAATCATGGATCAAGG + Intergenic
981154544 4:141418211-141418233 ACAATTGAACTCATGGAACATGG - Intergenic
981210160 4:142093981-142094003 ACATTGGAGACCATGGAATATGG + Intronic
982198865 4:152940162-152940184 ACATTGGACATCCTGGCCCAGGG + Intronic
983301611 4:165933394-165933416 ACTATGGAAATCAGGGATGATGG + Intronic
983403291 4:167292906-167292928 ACATTGGAAATCATAGACCAAGG + Intergenic
984208795 4:176820032-176820054 ACATTGGAAAAGGAGGATCAAGG + Intergenic
984284620 4:177713549-177713571 ACATTGGAATTCTTCCATCATGG - Intergenic
984692706 4:182746217-182746239 ACATTTGAAACCACGGACCACGG - Intronic
987102922 5:14608296-14608318 AGATTGGAAGTCAGAGATCAGGG + Intronic
987899948 5:23998483-23998505 ACATTGGAAATCATGGATCAAGG - Intronic
988146893 5:27320718-27320740 ACATTGCATATCATAGATCGGGG - Intergenic
988196275 5:28010093-28010115 ACATTGTATTTTATGGATCAAGG + Intergenic
988339414 5:29950592-29950614 ACTTTGGACATCATGAAGCATGG - Intergenic
989121935 5:38013280-38013302 ACATTGGAAATCAGAGGTTATGG + Intergenic
992755255 5:79898850-79898872 AAATTGTTAATCATGAATCAAGG + Intergenic
992757421 5:79921377-79921399 AGATTGGAAATGCTGGCTCAGGG + Intergenic
993336707 5:86668636-86668658 ACATTGGAAAACAGGCACCAAGG - Intergenic
996177408 5:120377028-120377050 AAACTGGAAATCTTAGATCAAGG + Intergenic
996417008 5:123221459-123221481 CCATTGGAAATAATAGATGAAGG + Intergenic
996762232 5:126998105-126998127 ACATGGGAAATCTTGGGTCTTGG + Intronic
996806682 5:127463235-127463257 ACATAGGAAAACATGTATCATGG + Intronic
997949691 5:138232422-138232444 ACATTGGTTATTATGGGTCAGGG - Intergenic
998898336 5:146824403-146824425 AAATTGGAAATCATATAACATGG - Intronic
999334366 5:150702861-150702883 ATATTGCAAATCATGCATAATGG + Intergenic
1000742999 5:164993933-164993955 ACAATGGCAATCATGGCTGATGG + Intergenic
1000865594 5:166511001-166511023 GTATTGGAAATCATAGATAAAGG - Intergenic
1003773502 6:9334633-9334655 ACATAGGCAATCATGTACCATGG + Intergenic
1004251441 6:14026236-14026258 GCATCAGAAATCATGGAGCAGGG + Intergenic
1005831889 6:29677620-29677642 CCATTGGAAATCATGTAGCTGGG + Intronic
1010628299 6:78166508-78166530 ACCTTGGAAATCCAAGATCAAGG + Intergenic
1015401206 6:132790328-132790350 AAAATGGAAATAATAGATCAGGG + Intronic
1015469305 6:133585634-133585656 AGATTGGAAATCAAAGGTCAAGG - Intergenic
1015830215 6:137360675-137360697 AGATTGGAAGTCAGAGATCAGGG - Intergenic
1016153503 6:140774036-140774058 ACATTGTAAAACATGGATTTTGG + Intergenic
1016324082 6:142879891-142879913 TCATTGGAAGTCAGAGATCATGG - Intronic
1017380319 6:153820899-153820921 ACATAGGAAACCATGTGTCATGG + Intergenic
1018718157 6:166551367-166551389 ACATTGGAAATCCTCTCTCAAGG - Intronic
1020579476 7:9977323-9977345 ACCTTAAAAATCATGGACCAAGG - Intergenic
1021785875 7:24152120-24152142 AGATTGGAAAGCATGAACCAGGG + Intergenic
1022075747 7:26968232-26968254 ACATAGGAAAACATGTGTCATGG + Intronic
1022361302 7:29661500-29661522 AAATTGGAAATAATGTATTAAGG - Intergenic
1027531948 7:79345874-79345896 ACAGTGGAAATAATGGATAAGGG - Intronic
1027686465 7:81284882-81284904 ACATTTAAAATCTTGGATCCAGG - Intergenic
1027965777 7:85004902-85004924 CCATTGAAATTCATGGAGCATGG + Intronic
1028175192 7:87648264-87648286 ACAGAAGAAATCATTGATCATGG + Intronic
1028468778 7:91182104-91182126 ACACTGGAAATTATGGCTAATGG + Intronic
1028601286 7:92603072-92603094 ACCTTGGAAATCATGCTTAAGGG - Intergenic
1030713042 7:112775254-112775276 CCATTGGAATCCATGGCTCATGG - Exonic
1032311280 7:130789726-130789748 AGTTTGGAAATCATAAATCAGGG + Intergenic
1032363201 7:131275134-131275156 AGACTGGAAATCCTAGATCAGGG + Intronic
1034231966 7:149537216-149537238 ACATTGGACATCAAGCAGCAAGG + Intergenic
1035431414 7:158825716-158825738 ACATAGGAAAACATGAATTAAGG - Intronic
1036704680 8:11038089-11038111 AAATTTGAAATCAGGGATCAGGG - Intronic
1037100372 8:15036500-15036522 ACATAGGTAAACATGTATCATGG - Intronic
1037308070 8:17526676-17526698 ATGCTGGAAACCATGGATCAGGG + Intronic
1037609996 8:20468093-20468115 ACATTAGAAATCATGGACAGAGG + Intergenic
1040449925 8:47534725-47534747 ACATAGGTAAACATGGGTCATGG - Intronic
1042002307 8:64138454-64138476 ACAGTGGAAACCATGAGTCAGGG - Intergenic
1042796421 8:72668215-72668237 ACCTTGGACATCAAGGCTCAGGG - Intronic
1043051949 8:75395380-75395402 ACATTTCAAATCCTGAATCATGG - Intergenic
1045522219 8:102913515-102913537 ACATGGGGAATCATGGACCACGG + Intronic
1046363136 8:113187403-113187425 AAATTGTAATTCAAGGATCAAGG + Intronic
1046565162 8:115890050-115890072 TCATTGGAAATCCTGAATCCAGG + Intergenic
1048277469 8:133077697-133077719 ACTTTGGACATTTTGGATCAGGG + Intronic
1048327726 8:133451967-133451989 AGGTTGGAAATCTGGGATCAGGG + Intergenic
1050228971 9:3496669-3496691 ACATTAAAAATCTGGGATCAAGG + Intronic
1056633190 9:88310443-88310465 ACATAGGAAGTCATGGAGGAGGG + Intergenic
1056707872 9:88967232-88967254 ACCTTGGATCTCATGGTTCATGG + Intergenic
1057504440 9:95621140-95621162 ACATCAGAGATCATTGATCACGG - Intergenic
1057792116 9:98131218-98131240 ACATTGGAACTCAAGAACCAGGG - Intronic
1061126862 9:128682617-128682639 ACATTAGTGATCATGGCTCACGG - Intergenic
1186003805 X:5045281-5045303 ACATGGGAGATGATGGAACAGGG - Intergenic
1187279928 X:17850408-17850430 ACATTGGGAGTCAGGGATAAAGG + Intronic
1190555654 X:51632479-51632501 AGACTGGAAATCAGAGATCATGG + Intergenic
1190767072 X:53484207-53484229 ACATTGGAAGTCTTCCATCATGG - Intergenic
1190958346 X:55219921-55219943 ACATTCAAAATCATTGATCCGGG - Intronic
1192823132 X:74665651-74665673 ACATTAGTAAACATGGCTCAAGG + Intergenic
1193308687 X:79979642-79979664 ACATAGGTAATCATGTGTCATGG + Intergenic
1193623405 X:83786081-83786103 ACATTTGAGAACAAGGATCAAGG + Intergenic
1193703675 X:84793903-84793925 ACTTCTGAAATCATTGATCAAGG - Intergenic
1194353347 X:92850345-92850367 ACATTGGAAATCCATGATAAAGG - Intergenic
1194655862 X:96572475-96572497 AAACTGGAAATCAGAGATCAAGG + Intergenic
1197430422 X:126355892-126355914 ACATTAGAAATCCTGGTTCTTGG - Intergenic
1197605924 X:128585079-128585101 CAATTGGAATTTATGGATCAGGG - Intergenic
1199518092 X:148701545-148701567 ACATCTGAAATCATGGATAATGG - Intronic
1200661701 Y:5967418-5967440 ACATTGGAAATCCATGATAAAGG - Intergenic
1201221556 Y:11775860-11775882 ACATTTCAAATCATAGTTCATGG - Intergenic