ID: 987900968

View in Genome Browser
Species Human (GRCh38)
Location 5:24011673-24011695
Sequence GTACCATATCAGATTAATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987900968 Original CRISPR GTACCATATCAGATTAATGG TGG (reversed) Intronic
909441853 1:75705054-75705076 GTATATTATCTGATTAATGGGGG - Intergenic
911871439 1:103106067-103106089 GTACCACATCAAATAAATGGTGG - Intronic
913977193 1:143470420-143470442 GTACAATATAAGATTTATAGAGG + Intergenic
914071597 1:144296049-144296071 GTACAATATAAGATTTATAGAGG + Intergenic
914107558 1:144670307-144670329 GTACAATATAAGATTTATAGAGG - Intergenic
917753709 1:178078315-178078337 CTATCATATCCAATTAATGGAGG + Intergenic
918918642 1:190675386-190675408 GTGCCCTCCCAGATTAATGGTGG + Intergenic
921260436 1:213381406-213381428 GAACTAGATCAGATTAATGGGGG - Intergenic
921559602 1:216641019-216641041 GTAACATATTAGATAAATGCTGG + Intronic
923132151 1:231085630-231085652 GTAGCATTTCAGATGAGTGGGGG - Intergenic
923401078 1:233615407-233615429 GTGCCAGATCAGATGAATGAAGG + Intronic
924498329 1:244611857-244611879 GTACCATATCATACCAATTGAGG - Intronic
1065424281 10:25582815-25582837 GTATGAAATCAGATTAATTGAGG + Intronic
1067051460 10:43023884-43023906 GTACCCAACCAGATTAAGGGTGG + Intergenic
1068838482 10:61582954-61582976 GTACCATATCTTATTCATGTAGG - Intergenic
1070274612 10:74993671-74993693 GTACTATTCCAGATTAAAGGAGG - Intronic
1073976690 10:109109904-109109926 CAACCAAATCAGGTTAATGGGGG + Intergenic
1081093786 11:38906208-38906230 GTATCATATCAGATTAATACAGG - Intergenic
1086547441 11:88014580-88014602 GTAACAAGTCATATTAATGGTGG + Intergenic
1087951004 11:104220265-104220287 GTACCCACTCAGATTAAGGGTGG - Intergenic
1096446284 12:51695470-51695492 TTGACATATCAGATTAGTGGGGG + Intronic
1097564345 12:61249949-61249971 GTGCCCTCTCAGATTAATGGTGG + Intergenic
1100294496 12:93248234-93248256 GTACCTTATCTGATTCATGGTGG - Intergenic
1105200641 13:18171685-18171707 GTACAATATAAGATTTATAGAGG - Intergenic
1105222035 13:18339394-18339416 GTACAATATAAGATTTATAGAGG - Intergenic
1105382490 13:19900599-19900621 GTCTGATATCAGAGTAATGGTGG - Intergenic
1109844139 13:67962079-67962101 TTACCATATAAGAATTATGGAGG + Intergenic
1116759877 14:48998812-48998834 GTACCCTCCCAGATTAAGGGTGG - Intergenic
1117341973 14:54799701-54799723 GTGGCATATCAGATCAGTGGAGG - Intergenic
1118448629 14:65876164-65876186 GAAGCCTATCAGACTAATGGTGG - Intergenic
1124904451 15:33855530-33855552 GGAATATATCAGATTCATGGAGG - Intronic
1128480936 15:68037337-68037359 GACCCATATCAGACTAATAGTGG + Intergenic
1135909479 16:26546041-26546063 GCACCATAGCACATTAAAGGGGG + Intergenic
1141730297 16:85818151-85818173 GAACCACATCAGCTTGATGGTGG - Intergenic
1145399652 17:22520939-22520961 GTACTATATAATATTCATGGTGG - Intergenic
1148730004 17:49828398-49828420 GTACTGTATCAGACTAGTGGAGG - Exonic
1157265705 18:46219315-46219337 GTATCATATCAAAATAATGCTGG + Intronic
1158059477 18:53321176-53321198 GCACTATTTCAGATGAATGGGGG + Intronic
1163963253 19:20717707-20717729 GTGCAATAACAGATTAAAGGTGG - Intronic
928002650 2:27538437-27538459 CTACCATATAAGCTTACTGGAGG - Intronic
930248169 2:49005916-49005938 GTACCCACTCAGATTAAGGGTGG - Intronic
934181896 2:89631398-89631420 GTACAATATAAGATTTATAGAGG + Intergenic
934292200 2:91705623-91705645 GTACAATATAAGATTTATAGAGG + Intergenic
935062131 2:99617875-99617897 GTTGCATATCAGGTTAGTGGAGG + Intronic
939554711 2:143660430-143660452 GTACCCTAACAGATTAAAGCAGG + Intronic
946083573 2:217149129-217149151 GTATCATATTAGAATAGTGGAGG + Intergenic
1169280621 20:4263972-4263994 GTACCATGGCAGGATAATGGAGG + Intergenic
1170495933 20:16925190-16925212 GTACCATATAAAATGAAGGGAGG - Intergenic
1170856085 20:20056598-20056620 TTATCATATCAGATTAATAGTGG + Exonic
1176730582 21:10491817-10491839 GTACAATATAAGATTTATAGAGG - Intergenic
1178181617 21:30168366-30168388 GTAACAAATCAGAGTAATGCTGG - Intergenic
1184899759 22:47438091-47438113 CTACCATATCATAGTAGTGGAGG + Intergenic
949451985 3:4196252-4196274 GTCCCATCTCAGCTTAATGAAGG + Intronic
952872603 3:37914478-37914500 ATACCATATCAGATTTAGGAAGG + Intronic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
957228631 3:77481823-77481845 GAACCATATCATATAAATGGTGG + Intronic
964721033 3:159767113-159767135 GTAGCATTTGAGGTTAATGGTGG + Intronic
966206512 3:177412035-177412057 GTAACATATCAGAATGAAGGTGG - Intergenic
970106370 4:12590107-12590129 GTACAAATTCAAATTAATGGTGG - Intergenic
972144954 4:36011885-36011907 GTTCCTTATCAAGTTAATGGGGG + Intronic
974116759 4:57588476-57588498 GTCCCATAACAATTTAATGGTGG - Intergenic
974425060 4:61731855-61731877 GTAGCATATCATGTGAATGGTGG - Intronic
975091211 4:70406512-70406534 TTATCATATCAAATTATTGGGGG + Intronic
979568113 4:122179903-122179925 GTACCATTCCAGATCAATGGAGG + Intronic
980255874 4:130380841-130380863 GTACCCTCTCAGATTGAGGGTGG - Intergenic
981079506 4:140624748-140624770 GTACAATAAAAAATTAATGGAGG + Intronic
982975868 4:162059015-162059037 ATACCATTTCAAAATAATGGAGG + Intronic
987128606 5:14839097-14839119 GTGCCATGTTAGCTTAATGGCGG + Intronic
987207945 5:15646709-15646731 TTACCATGTGATATTAATGGAGG + Intronic
987900968 5:24011673-24011695 GTACCATATCAGATTAATGGTGG - Intronic
993678279 5:90844596-90844618 TTAGCATATCAGATTCAGGGGGG - Intronic
994197705 5:96937163-96937185 GTACAGTATCACATTAATAGGGG + Intronic
996494293 5:124135990-124136012 GTGCCCACTCAGATTAATGGTGG - Intergenic
999626866 5:153530266-153530288 GTACCATAGCAGTTAAATGCAGG - Intronic
1000224830 5:159250397-159250419 GTCCCATCTCAGATCAGTGGTGG - Intergenic
1004144274 6:13050347-13050369 GTAAAATAACAGATTACTGGAGG - Intronic
1004747309 6:18523858-18523880 GTACCATAGCAGATTAATGTGGG - Intergenic
1005413634 6:25577785-25577807 GTACAATTTCAGAGTAATGTAGG + Intronic
1014765055 6:125396726-125396748 GTACTATATAATATTCATGGTGG + Intergenic
1017078952 6:150648657-150648679 GTACCTTATCAGATTTGTGCTGG + Intronic
1017663712 6:156698123-156698145 GGAGCATTTCAGATCAATGGAGG + Intergenic
1018617727 6:165703794-165703816 GTCCCATAGCTGATTACTGGGGG - Intronic
1021055275 7:16039693-16039715 TCACCATATCAAAGTAATGGTGG + Intergenic
1031228738 7:119076305-119076327 GTAGGATCTCAGATTAATGTGGG - Intergenic
1034598999 7:152229728-152229750 GTACAATATAAGATTTATAGAGG + Intronic
1046418091 8:113941400-113941422 GTGCCAGCCCAGATTAATGGTGG + Intergenic
1048139297 8:131777533-131777555 CTGCCAAAGCAGATTAATGGAGG - Intergenic
1050256989 9:3804266-3804288 GTAACAAATCAGATCAGTGGAGG - Intergenic
1053057048 9:34999478-34999500 GTACTATATAATATTCATGGTGG + Intergenic
1059196634 9:112376776-112376798 GTACCCACTCAGATTAAGGGTGG + Intergenic
1060363574 9:122985037-122985059 GTACAATATTAGAGAAATGGAGG + Intronic
1203583709 Un_KI270746v1:42254-42276 GTACAATATAAGATTTATAGAGG + Intergenic
1194605310 X:95972414-95972436 GTACTGTATCAGACTAGTGGAGG + Intergenic
1194981750 X:100448704-100448726 GATGCATATCAGATTAGTGGTGG + Intergenic
1198095247 X:133373779-133373801 GTGACATGTCAAATTAATGGAGG + Intronic