ID: 987906785

View in Genome Browser
Species Human (GRCh38)
Location 5:24088209-24088231
Sequence GAGTGGCCAGAGGCCTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 493}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987906785_987906798 25 Left 987906785 5:24088209-24088231 CCCACCCAGGCCTCTGGCCACTC 0: 1
1: 0
2: 2
3: 42
4: 493
Right 987906798 5:24088257-24088279 CTATTTCTTCCTGGGATGAAGGG 0: 1
1: 0
2: 0
3: 27
4: 411
987906785_987906794 16 Left 987906785 5:24088209-24088231 CCCACCCAGGCCTCTGGCCACTC 0: 1
1: 0
2: 2
3: 42
4: 493
Right 987906794 5:24088248-24088270 ACAGAGTTCCTATTTCTTCCTGG 0: 1
1: 5
2: 130
3: 268
4: 918
987906785_987906795 17 Left 987906785 5:24088209-24088231 CCCACCCAGGCCTCTGGCCACTC 0: 1
1: 0
2: 2
3: 42
4: 493
Right 987906795 5:24088249-24088271 CAGAGTTCCTATTTCTTCCTGGG 0: 1
1: 0
2: 8
3: 56
4: 376
987906785_987906797 24 Left 987906785 5:24088209-24088231 CCCACCCAGGCCTCTGGCCACTC 0: 1
1: 0
2: 2
3: 42
4: 493
Right 987906797 5:24088256-24088278 CCTATTTCTTCCTGGGATGAAGG 0: 1
1: 0
2: 0
3: 10
4: 237
987906785_987906790 -7 Left 987906785 5:24088209-24088231 CCCACCCAGGCCTCTGGCCACTC 0: 1
1: 0
2: 2
3: 42
4: 493
Right 987906790 5:24088225-24088247 GCCACTCCACCTGTAATCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987906785 Original CRISPR GAGTGGCCAGAGGCCTGGGT GGG (reversed) Intronic
900146016 1:1158922-1158944 GAGGGCCCTGGGGCCTGGGTAGG + Intergenic
900436742 1:2634582-2634604 GAGTGTCCAGTGACCGGGGTAGG - Intergenic
900593116 1:3468587-3468609 GAGAGGCCAGAGGGCGGGGGGGG - Intronic
900599963 1:3498715-3498737 GCGTGCCCAGAGGGCTGGGCCGG - Exonic
900796974 1:4713863-4713885 GATTCTGCAGAGGCCTGGGTGGG - Intronic
900984415 1:6065250-6065272 GACTGGCCTGAGGCCTGGGCAGG - Intronic
901134497 1:6984182-6984204 GAGTGGATAGAGGGATGGGTGGG + Intronic
901242315 1:7702820-7702842 GAGTGGCTGGAGGCTGGGGTTGG - Intronic
901272747 1:7965665-7965687 GTGTGGCCAGATGGGTGGGTTGG + Intronic
901520217 1:9778003-9778025 CAGTGCCCAAAGGCCTGGGTGGG + Intronic
901700481 1:11042597-11042619 GAGTGGACAGAAGGATGGGTGGG + Intronic
902481500 1:16714418-16714440 CAGTGGCCAGAAGCCTGTGACGG + Intergenic
902605564 1:17567243-17567265 AAGAGGCCAGTGGCCTGGGAAGG - Intronic
902795598 1:18798955-18798977 GAGTGGCTGGCGGCCAGGGTGGG - Intergenic
902954263 1:19914118-19914140 GAAAGGCCAGAAGCCTGGGGTGG - Intergenic
903953817 1:27011720-27011742 GTGGGGCCTGAGGCCTGGGTTGG + Intronic
904090755 1:27943450-27943472 GAATGTCCTGTGGCCTGGGTGGG + Intronic
904425500 1:30420105-30420127 GAGGGGCCAGAGGTCTGGGCTGG + Intergenic
904591269 1:31616853-31616875 GAGAGGCTAGAGGCCTGAGAGGG + Intergenic
905434556 1:37947611-37947633 GTGTGGCAGGAGGGCTGGGTGGG - Intergenic
905655204 1:39682402-39682424 GCTTGGGCAGAGGACTGGGTGGG + Exonic
905797310 1:40822987-40823009 GTGTGGCCAGGTGCCTGGCTAGG + Intronic
905865061 1:41372113-41372135 CAGAGGCCAGAGGCCAGGGTAGG - Intronic
905885313 1:41488559-41488581 GAGTGGCCCCAGGCCTGAGTGGG - Intergenic
906166963 1:43693776-43693798 CAGTGGGCAGTGGCCTAGGTGGG + Intronic
908004539 1:59714299-59714321 GTCTTACCAGAGGCCTGGGTTGG + Intronic
911315600 1:96353125-96353147 TAGGGGCCAGGGGGCTGGGTTGG - Intergenic
912474818 1:109928649-109928671 GTTGGGCCAGAGGCCTGGGCTGG + Intronic
912951901 1:114126029-114126051 GAGTGGGCAGGGGCCTGGGAAGG + Intronic
913080050 1:115375436-115375458 CAGTGGCCAGAGGACAGGCTAGG - Intergenic
915229128 1:154432846-154432868 CAGTGGCCTGAGGTCTGGGTGGG - Intronic
915255799 1:154627711-154627733 GGGTGGCCGCAGGGCTGGGTGGG - Intronic
915314317 1:155019394-155019416 GAGAGGCCAGAGAATTGGGTGGG - Intronic
915467624 1:156106614-156106636 GTGGGGACAGAGGCGTGGGTGGG - Intronic
915546053 1:156598559-156598581 GAATGGCAAGAGGCCTGTGTGGG - Intronic
917452969 1:175162412-175162434 CATTGTCCAGAGGTCTGGGTGGG - Intronic
917510181 1:175663203-175663225 GAGGGGCCAGAGCTCAGGGTGGG - Intronic
919767988 1:201139586-201139608 GTGTGGCCAGAGGCTGGGCTGGG - Intronic
920123520 1:203676061-203676083 GTGAGGCCAGAGGCCTGGCTTGG + Intronic
920438671 1:205964237-205964259 GAGGGGACTGAGGCCTGGGTTGG + Intergenic
921290122 1:213649430-213649452 CTGTGGCCAGAGGGCTAGGTGGG - Intergenic
922220841 1:223557436-223557458 CAGTGGGCACTGGCCTGGGTGGG - Intronic
922353595 1:224755927-224755949 GAGGGGCCAGGGGCCAGGATGGG + Intergenic
922450438 1:225732963-225732985 AAGTGCCCAGATGCCTGGGGAGG + Intergenic
922582684 1:226710529-226710551 GAGTGGCCAGAGTCAAGGGGCGG - Intronic
923409258 1:233691070-233691092 GAGTGGCCAGGGGAGGGGGTTGG - Intergenic
924568544 1:245218127-245218149 CAGAGGCCAGAGGCCATGGTGGG + Intronic
924676029 1:246178953-246178975 GAATGGCCAGAGGCCCCTGTAGG + Intronic
1064923734 10:20547468-20547490 GAGTTGCCTGAGGTCTGAGTTGG - Intergenic
1065268758 10:24004902-24004924 GAGTGACCAGAAGCCTTGTTTGG + Intronic
1065917753 10:30366831-30366853 AAGGGGCCAGGGGCCTGGGCGGG - Intronic
1065954025 10:30677422-30677444 GAGGGGACAGAGGCCTCAGTGGG - Intergenic
1065954053 10:30677510-30677532 GAGGGGACAGAGGCCTCAGTGGG - Intergenic
1065954068 10:30677554-30677576 GAGGGGACAGAGGCCTCAGTGGG - Intergenic
1066509756 10:36083274-36083296 GGATGGCCAGAGGCCCTGGTTGG + Intergenic
1067167677 10:43878494-43878516 GAGAGACGAGAGGCCAGGGTGGG + Intergenic
1068811144 10:61257213-61257235 GAGTGGCCAGAGGCCCTAGCTGG + Intergenic
1069190326 10:65479468-65479490 CAGGGGCCAGAGACCTGGGCTGG - Intergenic
1069554023 10:69384956-69384978 GAGTCCCCTGTGGCCTGGGTGGG + Intronic
1069604775 10:69732264-69732286 GTGTGGCCAGAGAGGTGGGTGGG + Intergenic
1070381804 10:75887418-75887440 GTGTTGACGGAGGCCTGGGTGGG + Intronic
1070666588 10:78349391-78349413 CAGGTGCCAGAGTCCTGGGTTGG + Intergenic
1070730761 10:78826730-78826752 GAGGGAACAGAGGCCTGGGGTGG - Intergenic
1070831768 10:79422249-79422271 GAGTGGCTAGAGCCCAGGGAGGG - Intronic
1071301989 10:84262647-84262669 GTGTGGCTAGAGGCCAGGGCAGG - Intergenic
1071999927 10:91185210-91185232 GGGTGGCTGGAGGCCTGGGTTGG + Intronic
1072747396 10:97950529-97950551 GCGTGGTCTGAGGTCTGGGTTGG + Intronic
1073041895 10:100613412-100613434 GTGTGTGCCGAGGCCTGGGTGGG + Intergenic
1073447735 10:103591324-103591346 GATGGGCCAGGGCCCTGGGTGGG + Exonic
1074097943 10:110330413-110330435 GAGGGGCCCCAGGCCAGGGTTGG + Intergenic
1074897348 10:117788802-117788824 GAGCGGGCAGAGGCCAGGCTGGG + Intergenic
1075356642 10:121783995-121784017 GGGAGGCCGGAGGCCAGGGTGGG - Intronic
1076405279 10:130208110-130208132 CAGTGGCCTGAGACCTGGCTGGG + Intergenic
1076430613 10:130399345-130399367 CAGTGGTCAGCGGCCAGGGTTGG + Intergenic
1076804014 10:132846253-132846275 CAGGGGCCCGAGGCCTGGGCGGG + Intronic
1076829951 10:132989100-132989122 GAGGGGCCTGAGGCCTGGTGGGG + Intergenic
1077372494 11:2190006-2190028 GCGTGCACAGAGGCCTGGGCTGG + Intergenic
1077399966 11:2350080-2350102 GAGTGGCCCAAGGCCTGGGGTGG + Intergenic
1080049876 11:27848550-27848572 GAGAGACCAGAGGGCTGGGATGG + Intergenic
1081540192 11:44029173-44029195 GAGAGGCCAGAAGCCTTTGTAGG - Intergenic
1083460418 11:62807298-62807320 GGGTGGCCAGAGGCAAGGGGTGG + Exonic
1083625913 11:64071867-64071889 TAGTGGCGAGAGCCCTGGGAGGG + Intronic
1083776984 11:64898848-64898870 GGGTGGACAGAGGCCTGGCCAGG + Intronic
1083904640 11:65662064-65662086 TAGGGGCCAGAGGCCTGGGCTGG + Exonic
1084111349 11:67015911-67015933 GAGAAGCCAGAGGCCTGGCCAGG + Intronic
1084453345 11:69252806-69252828 GAGTTGGCAGAGGCTGGGGTGGG + Intergenic
1084967305 11:72751484-72751506 GAGTCCCCAGAGGCCAGGCTGGG - Intronic
1085049985 11:73375483-73375505 GCTGGGCCAGAGGCCTGGCTGGG - Intergenic
1085341913 11:75737334-75737356 GAGTGGAAAGAGCACTGGGTGGG - Intergenic
1087146695 11:94820359-94820381 GAGTGTACAGAGGCCAGGGGAGG - Intronic
1087606547 11:100384443-100384465 GGGTGGCCAGAGGCCCTGGCTGG - Intergenic
1089171649 11:116515862-116515884 GAGGGGCCAGCTGCCTGGGATGG + Intergenic
1089469116 11:118706649-118706671 GAGAGGCCAAAGGGCTGGGCTGG - Intergenic
1090183760 11:124722609-124722631 AGGAGGCAAGAGGCCTGGGTGGG - Intergenic
1090245754 11:125214822-125214844 GAGTGGACAGAAGCCTTGGAGGG - Intronic
1090277793 11:125431904-125431926 CAGTGGCCAGAGGAGTGGGAGGG + Exonic
1090398568 11:126434554-126434576 GTGTGGCAGGAGGCCTGGGATGG + Intronic
1090807703 11:130212707-130212729 GAGAGGCCAGAGGCCTGCGTAGG + Intergenic
1090883144 11:130852274-130852296 GAGAGGACAGTGGCCTGAGTGGG + Intergenic
1091445255 12:541451-541473 GAGTGGGCAGAGGGCAGGGCTGG + Intronic
1091882232 12:3989323-3989345 GAGTGACCAGAGCCCGGGCTAGG - Intergenic
1091995447 12:4989283-4989305 AAGTGCCCAGAGGTCTGGGAGGG + Intergenic
1093376331 12:18432374-18432396 CAGTTCCCAAAGGCCTGGGTGGG - Intronic
1093972047 12:25384577-25384599 CAGTGGGGAGAGGTCTGGGTGGG - Intergenic
1094168514 12:27466611-27466633 GGGTGGACAGAGGGCTGGGGTGG + Intergenic
1094490181 12:30955962-30955984 GGGTGGCCAGTGGTTTGGGTTGG - Intronic
1096235500 12:49923467-49923489 GAGTGGCCAAGGGCTGGGGTGGG + Intergenic
1096252867 12:50044547-50044569 GAGTGGTCAGAGGCCCAGGGGGG + Intergenic
1097068611 12:56338692-56338714 CTGTGGCTAGAGGCCTGGGATGG - Intronic
1100665412 12:96746693-96746715 GTGTGACCAGAGGGTTGGGTGGG - Intronic
1100980586 12:100159284-100159306 AAGGGGCCAGGGGCCTGGGTAGG - Intergenic
1101883607 12:108642491-108642513 GAGTGTCAGGAGGGCTGGGTGGG - Intergenic
1103175872 12:118862615-118862637 GAGTGGCCAAGGGCGTGGGATGG + Intergenic
1103366634 12:120389039-120389061 AGGTGGGCAGAGCCCTGGGTCGG + Intergenic
1103443131 12:120978394-120978416 GAGTGGGCAGAGGGGAGGGTGGG - Intergenic
1103703796 12:122860891-122860913 GAGGGGCGAGAGGTCAGGGTGGG - Intronic
1104035711 12:125095879-125095901 AACTGGCCAGAGGCATGGCTGGG - Intronic
1104260466 12:127177459-127177481 GAGTGCCCAGAGGTCAGGTTGGG - Intergenic
1104837681 12:131802159-131802181 GAGTGGTTAGAGGGCTGGGTGGG - Intergenic
1105811873 13:24002532-24002554 CAGTGGCCTGAGGCCTGGTCAGG + Intronic
1107094962 13:36526426-36526448 GGGTGTCCAGAGGCCAGGGCTGG - Intergenic
1108597530 13:51962317-51962339 CAGTGGCAAGAAGCCTGGGCTGG - Intronic
1109870741 13:68328938-68328960 CAGTGGACAGAGGCCAGGGATGG + Intergenic
1110338615 13:74363031-74363053 GAGTGGCCAGAGGAGAGGGGAGG - Intergenic
1110364064 13:74661439-74661461 GAATGGACAGAGGCTTGGGGAGG + Intergenic
1113163764 13:107414031-107414053 GGGAGGCCAGAGGCCAAGGTGGG - Intronic
1113225919 13:108159463-108159485 CAGTGGCAAGAGCCTTGGGTTGG - Intergenic
1113399314 13:109976462-109976484 GAGAGACCAGAGACTTGGGTGGG - Intergenic
1113813954 13:113159020-113159042 GAGTGGGGGGAGGCCTGGGTTGG + Intronic
1114435246 14:22700852-22700874 GAGTAGACAGAGGTCTGGTTGGG - Intergenic
1114654412 14:24307588-24307610 GAGTGGCTAGAGGGCTAGGGAGG + Exonic
1116320369 14:43454566-43454588 GGGTGGCTAGAGGCCTGGCTGGG - Intergenic
1116862196 14:50003581-50003603 GAGTCGCCAGAGGCCGGTGGTGG - Intronic
1118609313 14:67527865-67527887 AAGAGGCCAGAGGTCTGGGGTGG - Intronic
1118613556 14:67559979-67560001 GAGTGGACACTGGCCTGTGTGGG - Intronic
1118723581 14:68610637-68610659 GAGGGACCAGAAGACTGGGTAGG - Intronic
1118957588 14:70497236-70497258 GGGTGGCTTGAGGCCTGAGTTGG - Intergenic
1119194601 14:72708236-72708258 GACTGGCCAGAGGCAGGGCTGGG - Intronic
1119649691 14:76374933-76374955 GAGGGGCCAGCCGCCTGGGCAGG - Intronic
1120063164 14:80009088-80009110 TTCTGGCAAGAGGCCTGGGTGGG + Intergenic
1120336310 14:83160811-83160833 GAGCTGCCAGATGCCTGGTTTGG - Intergenic
1121273488 14:92652589-92652611 GAATGGGCAGTGGCCTGGGCAGG - Exonic
1121491470 14:94364222-94364244 GACTGGCCAGAGGGCTGGGGAGG - Intergenic
1121494209 14:94380775-94380797 GACTGGCCAGAGGGCTGAGGAGG - Intronic
1121744829 14:96279866-96279888 CAGTGGCCAGAGGCCAGCGGGGG + Intergenic
1122171279 14:99877562-99877584 GAGTGCTCAGAGGCCTGGGAAGG - Intronic
1122199863 14:100115968-100115990 GGGTGGACAGAGCCCTGGGCCGG + Intronic
1122685733 14:103505155-103505177 GCTTGGGCAGAGGCCTGGGTGGG + Intergenic
1122891643 14:104734800-104734822 GTTTGGTCAGGGGCCTGGGTCGG - Intronic
1123066521 14:105622050-105622072 GGGTGGCCTGAGGGGTGGGTGGG - Intergenic
1123079572 14:105685797-105685819 GAGGGTCCTGAGGCCGGGGTAGG + Intergenic
1123473297 15:20570333-20570355 AAGGGGCCAGGGGCCTGGGCAGG + Intergenic
1123644711 15:22430020-22430042 AAGGGGCCAGGGGCCTGGGCAGG - Intergenic
1123733597 15:23165344-23165366 AAGGGGCCAGGGGCCTGGGCAGG + Intergenic
1123751726 15:23362719-23362741 AAGGGGCCAGGGGCCTGGGCAGG + Intronic
1124284098 15:28386643-28386665 AAGGGGCCAGGGGCCTGGGCAGG + Intronic
1124298599 15:28524971-28524993 AAGGGGCCAGGGGCCTGGGCAGG - Intronic
1124630824 15:31336141-31336163 GAGTGGTCAGGGCCCTGGGTGGG + Intronic
1126145160 15:45466893-45466915 GGGTAGCCTGAGGCCTGGATAGG + Intergenic
1127772931 15:62245083-62245105 AAGGGGCCAGGGGCCTGGGCAGG - Intergenic
1127921955 15:63501482-63501504 GGATGTCCAGAGGGCTGGGTGGG + Intergenic
1127959976 15:63883627-63883649 GAGTGGTCAGAGTCCAGGGCTGG + Intergenic
1128244196 15:66121732-66121754 CAGTGGCCAGACGCTTGGGCAGG - Intronic
1128294397 15:66505459-66505481 GAGTGGCAAGAGGCTTAGGGCGG - Intronic
1129030020 15:72611261-72611283 AAGCGGCCAGGGGCCTGGGCAGG + Intergenic
1129475908 15:75784573-75784595 AAGGGGCCAGGGGCCTGGGCAGG + Intergenic
1130259326 15:82343316-82343338 AAGGGGCCAGGGGCCTGGGCAGG - Intronic
1130269351 15:82435849-82435871 AAGGGGCCAGGGGCCTGGGCAGG + Intronic
1130281939 15:82525866-82525888 AAGGGGCCAGGGGCCTGGGCAGG + Intergenic
1130473307 15:84242029-84242051 AAGGGGCCAGGGGCCTGGGCAGG + Intronic
1130480721 15:84356093-84356115 AAGGGGCCAGGGGCCTGGGCAGG + Intergenic
1130484916 15:84393520-84393542 AAGGGGCCAGGGGCCTGGGCAGG + Intergenic
1130490991 15:84431666-84431688 AAGGGGCCAGGGGCCTGGGCAGG - Intergenic
1130502575 15:84510465-84510487 AAGGGGCCAGGGGCCTGGGCAGG - Intergenic
1130595592 15:85246624-85246646 AAGGGGCCAGGGGCCTGGGCAGG + Intergenic
1131188229 15:90293383-90293405 AAGGGGCCAGGGGCCTGGGCAGG + Intronic
1131272685 15:90956744-90956766 GAGCGGCCGGGGGCCTGGTTCGG + Exonic
1132087663 15:98921495-98921517 GAGTGGGAGGAAGCCTGGGTGGG + Intronic
1132432729 15:101774044-101774066 AAGGGGCCAGGGGCCTGGGCAGG - Intergenic
1132710362 16:1263586-1263608 TAGTGGGAAGAGGCCGGGGTTGG + Intergenic
1133186942 16:4106714-4106736 GAGTGTGCAGAAGCCTGCGTGGG - Intronic
1133346190 16:5072060-5072082 GAGTGGCCAAGGGTCTGGGAGGG + Intronic
1135891936 16:26365313-26365335 GAGCAGACAGAGGCCTGGGAGGG + Intergenic
1136061368 16:27728884-27728906 AAGTAGGCAGAGGCCTGGGCAGG + Intronic
1136071024 16:27787169-27787191 GAGCACCCAGAGGCCTGGATGGG - Intergenic
1136684097 16:31983979-31984001 GAGGGGCAGGAGGCCAGGGTGGG + Intergenic
1136784722 16:32927531-32927553 GAGGGGCAGGAGGCCAGGGTGGG + Intergenic
1136885061 16:33926275-33926297 GAGGGGCAGGAGGCCAGGGTGGG - Intergenic
1138348460 16:56334006-56334028 GCTTGGCCTGAGGCCTGGGCAGG + Intronic
1138607500 16:58098408-58098430 GAGTGGCCAGAGGAGGGAGTGGG - Intergenic
1139486031 16:67257118-67257140 GAGTGCCCACAAGGCTGGGTAGG + Intronic
1139530902 16:67542272-67542294 GAGTGGCCAGGGTCCAGGGCAGG - Exonic
1140105151 16:71952937-71952959 GAGAGGCAGGAGGCCTGGATGGG + Exonic
1140423878 16:74843924-74843946 AAGTGGCCAGAGACCTGCGAAGG + Intergenic
1140431569 16:74908840-74908862 AAGTGGCCAGAGACCTGGGAAGG - Intronic
1140791693 16:78398239-78398261 CAGATCCCAGAGGCCTGGGTGGG - Intronic
1141136357 16:81468185-81468207 CAGGGGCCAGAGGGCTGGGGAGG + Intronic
1141714508 16:85719011-85719033 GAATGGCCAGGGGCTTGGGAAGG + Intronic
1142076300 16:88120083-88120105 GAGTGTGCTGAGGCCAGGGTGGG + Intergenic
1142106189 16:88304167-88304189 GAGTGGGGAGAGGCTTGGGAAGG + Intergenic
1142121971 16:88390958-88390980 GTGTGGGCAGCTGCCTGGGTCGG - Intergenic
1142141841 16:88476075-88476097 GTGGGGTCTGAGGCCTGGGTGGG - Intronic
1142147549 16:88498919-88498941 CACTGGCCCCAGGCCTGGGTGGG + Intronic
1142151174 16:88513128-88513150 TAGTGGTCAGAGCCCTGGGCTGG + Intronic
1203012668 16_KI270728v1_random:313207-313229 GAGTGCACTGAGGCCTGTGTTGG + Intergenic
1203031003 16_KI270728v1_random:586366-586388 GAGTGCACTGAGGCCTGTGTTGG + Intergenic
1203040718 16_KI270728v1_random:748065-748087 GAGTGCACTGAGGCCTGTGTTGG - Intergenic
1203087380 16_KI270728v1_random:1191537-1191559 GAGGGGCAGGAGGCCAGGGTGGG + Intergenic
1143374231 17:6457910-6457932 TACTGGGCAGAGACCTGGGTTGG - Intronic
1143412910 17:6722806-6722828 TAGAGCCCAGAGGACTGGGTTGG - Intergenic
1143597607 17:7924579-7924601 GAGTTGCCTGGGGCCTTGGTGGG - Intronic
1144737508 17:17563341-17563363 GAGGGGTCAGAGGCCAGGTTTGG - Intronic
1146838698 17:36134397-36134419 CACTGGCCAGAGTCCTGGGATGG - Intergenic
1146907833 17:36629499-36629521 TAGTGGCCAGAGGGCAGGGCTGG + Intergenic
1146946479 17:36877156-36877178 CAGAAGCCAGAGGCCTGGGCCGG + Intergenic
1147145024 17:38479673-38479695 GAGGGGCGGGAGGCCAGGGTGGG + Intronic
1147204228 17:38825141-38825163 GAGTGGAGGGAGGCCTGGGCGGG - Intronic
1147951765 17:44111438-44111460 GGGTGGCCAGAGGCTGGGCTGGG + Intronic
1148126036 17:45237470-45237492 GGGTGGGCACAGGCCTGGCTAGG - Intronic
1148128208 17:45247626-45247648 AAGGGGCCAGATGCCCGGGTGGG - Intergenic
1148191089 17:45679093-45679115 GACTGGCCAGGGGCAAGGGTGGG - Intergenic
1149528277 17:57375276-57375298 GACTAGCTAGAGGCCTGGGAAGG - Intronic
1151189679 17:72389069-72389091 GAGCGGCCAGAGGCCCTGGAGGG - Intergenic
1151310812 17:73291519-73291541 GTCTCGCCAGAGGCCTGGGCAGG + Intronic
1151657700 17:75503361-75503383 GACTGTCCTGAGGCCTGGCTGGG - Intronic
1152029038 17:77830449-77830471 GTGTGTCCAGAGGGGTGGGTGGG - Intergenic
1152237633 17:79146845-79146867 GAGGGGGCAGAGGCCTGAGGAGG + Intronic
1152318186 17:79593048-79593070 GAGTGGCAAGAGCCCAGTGTGGG - Intergenic
1152405638 17:80096504-80096526 GAGTGGTCAGGGGCCGGGCTAGG - Intronic
1152657753 17:81527858-81527880 GTGTGGCCAGAGGCCGGTCTGGG + Intergenic
1153059772 18:983016-983038 GAGAGGCCAGGGTCATGGGTGGG - Intergenic
1153952507 18:10069114-10069136 GAGGGGTGAGAGGCATGGGTGGG + Intergenic
1154066447 18:11111195-11111217 GTGCGGCCAGAGTCCTGGGCTGG - Intronic
1154274535 18:12947897-12947919 GAGGGGCCAGGGGACTGTGTGGG + Intronic
1155173000 18:23280940-23280962 GGGTGGGGAGAGGCGTGGGTGGG - Intronic
1155627940 18:27858117-27858139 CAGTGGCCAGTGGCCAGGGAGGG - Intergenic
1156462744 18:37330762-37330784 GAGTGCCCAGAGGCCAGAATTGG + Intronic
1158844300 18:61425414-61425436 GAGGGGGCAGAGGCATGAGTAGG + Intronic
1159944777 18:74436306-74436328 GACAGGTCAGAGGCCAGGGTGGG + Exonic
1160449246 18:78950818-78950840 GAGTGGGCAGAGGCCCTTGTGGG - Intergenic
1160607900 18:80066076-80066098 GAGTGTGCAGGGTCCTGGGTGGG + Intronic
1160775534 19:853435-853457 CGGAGGCCAGAGGCCTGGGGAGG + Intronic
1161288586 19:3480820-3480842 GAGTGGCACGGGGCCTGGGCCGG - Intergenic
1161319553 19:3634630-3634652 GAGCTGGCAGAGGCATGGGTTGG - Intronic
1161449242 19:4335393-4335415 GAGTGGGCAGACGGGTGGGTGGG - Intronic
1161680514 19:5677670-5677692 GTGGGGCCAGAGGCCTCCGTAGG - Intronic
1161937441 19:7380883-7380905 GAGGGGACAGATACCTGGGTCGG - Intronic
1162180869 19:8867825-8867847 GAGTGGGCAGAAGGATGGGTGGG + Intronic
1162459101 19:10803727-10803749 GGGTGGCCCCAGCCCTGGGTGGG + Intronic
1162533152 19:11247465-11247487 TTCTGGCCTGAGGCCTGGGTGGG - Intronic
1162789228 19:13054487-13054509 GAGTCTCCAGAGTCTTGGGTGGG + Intronic
1163191007 19:15676516-15676538 GAGTGGGCAGAGGAATGAGTGGG - Intronic
1163268343 19:16234522-16234544 GGGTGGCCAGAGACCAGGGAGGG - Exonic
1163600618 19:18247184-18247206 CAGTGGCCACAGCCCTGGGCTGG + Intronic
1164535825 19:29086103-29086125 GAGCTTCCAGAGGCCTGGGCAGG + Intergenic
1164588872 19:29495215-29495237 CAGTGGTCAGAGCCCTGGGCTGG + Intergenic
1165385730 19:35509847-35509869 GAGTGGGCACAGTCCTGGGCAGG + Intronic
1167612350 19:50513615-50513637 GAGAGGACAGAGACCTGGGGTGG + Intronic
1168173386 19:54606263-54606285 TGGTGGCCATGGGCCTGGGTCGG + Intronic
925290307 2:2743675-2743697 GAGTGGGCAGAGGGCAGGGCTGG - Intergenic
925574574 2:5348154-5348176 CAGTGTACAGAGGGCTGGGTGGG - Intergenic
926159156 2:10475606-10475628 CAGTGGCAGGAGGCCTGGGCCGG + Intergenic
927079017 2:19609625-19609647 GAGTAGCCAGAGACATGGGAGGG - Intergenic
927850201 2:26494087-26494109 TGGTGGCCAGAGCCCTGGGCTGG + Intronic
929562478 2:42964478-42964500 TGCTGGCCAGAGGCCTGGGCTGG - Intergenic
929713195 2:44285413-44285435 GAGTGGCCAGAGATGTGGGAGGG + Intronic
929862755 2:45693484-45693506 GAATGCCCCGAGGCATGGGTAGG + Intronic
932335948 2:70931524-70931546 GAGGGGCCAGATGCCTGTCTGGG - Intronic
932570087 2:72934019-72934041 GAGTGGCCAGAGTCCAGCTTGGG - Exonic
932832798 2:75007188-75007210 GAGGAGGCAGAGGCCTGGCTTGG - Intergenic
933902450 2:86859761-86859783 GAGAGGACACAGACCTGGGTAGG + Intronic
933918066 2:87016811-87016833 GAGGGGTCAGGGGCCAGGGTGGG - Intronic
934004928 2:87753103-87753125 GAGGGGTCAGGGGCCAGGGTGGG + Intronic
934653945 2:96107776-96107798 GAGTGGCCACCTGCCTGGGCGGG - Intergenic
934809913 2:97269470-97269492 GGGTGGCCGGAGGCCCCGGTTGG - Intergenic
934827779 2:97438469-97438491 GGGTGGCCGGAGGCCCCGGTTGG + Intergenic
935407132 2:102720931-102720953 GAATGGCCAAAGCCCTGGGTGGG + Intronic
935624654 2:105162169-105162191 GAGTGGACAGAGGCCGGGCGCGG + Intergenic
935743924 2:106174638-106174660 GAGAGGCCACAGCCCTGGGGAGG + Intronic
935778097 2:106489507-106489529 GAGAGGACACAGACCTGGGTAGG - Intergenic
936737544 2:115464698-115464720 GAATGTTCAGAGTCCTGGGTAGG + Intronic
937118919 2:119428776-119428798 GAGTGGTCAGAGGGGTGGGAAGG + Intergenic
937157386 2:119730674-119730696 GAGGGGCTAGAGGGCTGTGTAGG + Intergenic
937212541 2:120284800-120284822 CAGTTGCCAGAGGCCAGGGGTGG - Intronic
937564437 2:123266884-123266906 GATTGTCCAAAGGACTGGGTGGG - Intergenic
937957014 2:127427248-127427270 GGGCTGCCAGAGGCCTGGGTAGG + Intronic
939546373 2:143559381-143559403 GGCTGGACAGAGGCCTGAGTTGG + Intronic
940347763 2:152645235-152645257 GGGTGGTCAGAGAGCTGGGTGGG + Intronic
940831447 2:158470838-158470860 GATTGGCCAGAGTCCTGAGAAGG + Intronic
940831798 2:158474785-158474807 GATTGGCCAGAGTCCTGAGAAGG - Intronic
942138716 2:172955848-172955870 CAGTGGCCACAGGGCTGGGCAGG - Intronic
943247418 2:185473335-185473357 GGATGGCCTGAAGCCTGGGTGGG + Intergenic
944581557 2:201137091-201137113 GAGGGGGCAGCGGCCTGGGAAGG + Intronic
945966586 2:216193997-216194019 GAGTGGCCAGAGGACTAGGGAGG - Intronic
945995719 2:216434283-216434305 GAGCACCCAGATGCCTGGGTGGG + Intronic
946494664 2:220183764-220183786 GAGTGGACAGGGGCCAGGGCAGG + Intergenic
947271454 2:228340928-228340950 GAGTGGGAGGAGACCTGGGTAGG - Intergenic
947749961 2:232526759-232526781 GAGTGGCCATAGGCCAGGTGGGG - Intronic
947851561 2:233292751-233292773 GAGTGGCCGTGGGCCTGGGGCGG + Intronic
948262235 2:236612992-236613014 GAGAGTCCAGAGGGCTGGGGCGG - Intergenic
948551574 2:238776174-238776196 GAGTGGCCAGAGAGCAGGGCGGG + Intergenic
948601847 2:239111874-239111896 GAGTGCCCTGAAGCCTGAGTGGG + Intronic
948789554 2:240370249-240370271 GTGCGGCCAGTGGCCAGGGTTGG + Intergenic
1169113490 20:3047658-3047680 GAGAGGCCAGCAGGCTGGGTGGG + Intronic
1171975821 20:31593993-31594015 GAGAGGCCTGAGCCCTGGATGGG + Intergenic
1172188721 20:33048888-33048910 GTGTAGCCAGAGGCCTGATTAGG + Intergenic
1172444128 20:34984428-34984450 GGGAGGCCAGAGGCCGGGCTGGG + Intronic
1172761487 20:37326391-37326413 GAATGGCGAGAGCCCTGGGGGGG + Intergenic
1173228395 20:41175414-41175436 GAGTTGCCTGACTCCTGGGTGGG + Exonic
1173420780 20:42899131-42899153 GAGTGGGCAGAGCTCTGGGCTGG - Intronic
1173438794 20:43057103-43057125 TAGTTGCCAGGGGCTTGGGTGGG + Intronic
1173810438 20:45952142-45952164 CAGTGGCCCGAGGTCCGGGTAGG - Exonic
1173850623 20:46215791-46215813 AAGTGGGCAGAAGACTGGGTGGG + Intronic
1174185062 20:48700728-48700750 GAGTGGCCAGGAGGCTGGGATGG - Intronic
1174192813 20:48752247-48752269 AAGTGGGCAGAGGCATGCGTGGG - Intronic
1174381044 20:50155601-50155623 GAGGGAGCATAGGCCTGGGTGGG - Intergenic
1174391118 20:50218938-50218960 GAGTGGCCAGAGATCAGGGGAGG - Intergenic
1174543094 20:51304927-51304949 GAGGGACAGGAGGCCTGGGTGGG + Intergenic
1174551624 20:51366562-51366584 GAGTGGACAGGGGCCAGGATGGG + Intergenic
1175145111 20:56890035-56890057 GAGTGGCCAGAGGCCGGGCGCGG - Intergenic
1175400419 20:58697017-58697039 GAGGGGACAGGGTCCTGGGTGGG - Intronic
1175522183 20:59609052-59609074 GAGTGGCCAGTTGCCTGGCCAGG - Intronic
1175781279 20:61683896-61683918 GAGCAGCCAGAGGGATGGGTGGG + Intronic
1175879634 20:62249873-62249895 GACTTCTCAGAGGCCTGGGTGGG - Intronic
1176092423 20:63325167-63325189 GAATGCCCAGAGGGCTGGGAGGG + Intronic
1176093838 20:63330562-63330584 GAGTGGGCAGAGCCATGGGCAGG - Intronic
1176274680 20:64257284-64257306 GAGTGGCGACAGGCATGGGAAGG - Intronic
1178839466 21:36127301-36127323 GAGTGAACAGAGGCCTGGGAAGG - Intergenic
1178844479 21:36162926-36162948 GAGGGGCCAGAGGAGTGTGTGGG + Intronic
1179152640 21:38822055-38822077 GAGTGGACAGAAGGCTGGCTCGG - Intronic
1179368284 21:40779835-40779857 TAGTGAGCAGAGGGCTGGGTGGG + Intronic
1179712918 21:43273450-43273472 GGGTTGCCAGCGGCCGGGGTGGG - Intergenic
1179997627 21:44981274-44981296 AAGGGGCCAGAGGTCCGGGTGGG - Intergenic
1180051860 21:45335229-45335251 GAGGGGGCACAGGCCTGGGAGGG - Intergenic
1180051899 21:45335323-45335345 GAGGGGGCACAGGCCTGGGGAGG - Intergenic
1180051943 21:45335436-45335458 GAGGGGGCACAGGCCTGGGGAGG - Intergenic
1180201672 21:46228533-46228555 GAGTCGCCAGCGGCCGAGGTCGG + Exonic
1180247422 21:46557529-46557551 GAGTGCCCAGGGTGCTGGGTGGG + Intronic
1180711434 22:17842147-17842169 GAGTTGCCAGAGGCCAGAGAAGG + Intronic
1180858273 22:19061958-19061980 GAATGGCAAGGGTCCTGGGTGGG - Intronic
1180871950 22:19151123-19151145 GTGTGGCCAGAGGACTGGCCTGG - Intergenic
1181127874 22:20712456-20712478 GGGTGGCCACAGGCCGGGGGAGG - Intronic
1181146702 22:20853559-20853581 GAGAGGGCTGAGGACTGGGTAGG + Intronic
1182522735 22:30893406-30893428 GACTGGCCAGAGCCCTGCATGGG + Intronic
1183037131 22:35148920-35148942 GAATGTCTAGAGTCCTGGGTTGG + Intergenic
1183037380 22:35150542-35150564 GAATGTCTAGAGTCCTGGGTTGG - Intergenic
1183377920 22:37475799-37475821 AGGTGGGCAGAAGCCTGGGTGGG + Intronic
1183467992 22:37989749-37989771 GAGTGGTCAGAGGCTGGGCTGGG - Intronic
1183986244 22:41572097-41572119 TGGTGGGCAGAGGGCTGGGTAGG - Exonic
1184335484 22:43850531-43850553 ACGTGGCCAGAGACATGGGTGGG + Intronic
1184339379 22:43877785-43877807 GAGTGGCCTGAGGCCTGGAGAGG + Intergenic
1184340002 22:43880872-43880894 GAGTGGCCGGAGGGCTGTGGAGG + Exonic
1184456769 22:44615335-44615357 TAGAGGCCAGAGGCGTGGTTGGG - Intergenic
1184503121 22:44885792-44885814 GTGAGCCCAGAGGCCTGGGTGGG + Intronic
1184877469 22:47284584-47284606 GTGTGGTCAGAGCCCTGGGCTGG - Intergenic
1184915685 22:47567397-47567419 CAGAGGGCAGATGCCTGGGTTGG - Intergenic
949374151 3:3368241-3368263 GAGTGGAAAGAGGTCTGGGCTGG + Intergenic
950111184 3:10419752-10419774 CTGTGGCAAGAGGCCTGGCTCGG - Intronic
950114164 3:10439605-10439627 GAGTATCCAAAAGCCTGGGTTGG - Intronic
950138994 3:10602137-10602159 GAGGGGGCAGAGGCCAGGGCAGG - Intronic
950386527 3:12664398-12664420 GAGTGGCCAGAGGCCTAGAAGGG + Intergenic
950628656 3:14267061-14267083 GGGTGGCCAAAGGCTGGGGTGGG - Intergenic
953518889 3:43622337-43622359 GAGAAGGCAGAGGCCTGGTTGGG + Intronic
954121684 3:48503716-48503738 GAGTCCCCAGAGGCTAGGGTAGG - Intronic
954379236 3:50210891-50210913 GAGTGGCCAGGAGCTAGGGTGGG - Intronic
956172840 3:66446235-66446257 GAGTGGACGAAGCCCTGGGTGGG - Intronic
958640695 3:96800965-96800987 GAGTGGCTGGAGGCCTAGGCTGG + Intergenic
958728061 3:97930464-97930486 GAGTGGCCACAGGCAAGGTTAGG - Intronic
960943646 3:122951710-122951732 GAGGGGGCAGAGTCCTGGGCTGG + Intronic
961604148 3:128081413-128081435 GAGTGGACAGGGGCCAGGGCTGG + Intronic
961794836 3:129402033-129402055 GAGGACCCAGAGGCCTGGGGAGG + Intronic
963483444 3:145904908-145904930 GAGGGGCCACAGCCCTGGTTCGG - Intergenic
966849653 3:184156512-184156534 GAAGGGCCTGGGGCCTGGGTGGG + Intronic
968066152 3:195760859-195760881 AAGTGGCCCGAGGCCTGGGGAGG - Intronic
968150695 3:196335188-196335210 GGGTGGCCAGAGGACAGGGGAGG + Intronic
968384782 4:125945-125967 GATGGTCCAGAAGCCTGGGTTGG - Intronic
968480802 4:832255-832277 GTGTGGGCTGAGGCCTGGGGCGG + Intergenic
969259627 4:6025202-6025224 GGGTGGCCACAGGGGTGGGTGGG - Intergenic
969271766 4:6108018-6108040 GGGTGGGCAGAGGCCTGTGCAGG + Intronic
972042112 4:34615584-34615606 GAGTGGCCTGGGGCCTGGATGGG - Intergenic
973271118 4:48264288-48264310 GAGTGGCCAGAGGGATCTGTGGG - Intronic
974145758 4:57945278-57945300 GAGTAGCTGGAGGCCAGGGTAGG + Intergenic
974474322 4:62360562-62360584 GAGTGGTCAGAGGCCTGCAGTGG - Intergenic
975977531 4:80116039-80116061 GGGTGGCCAGAGGCCCTGGCTGG - Intronic
977557576 4:98500531-98500553 GACTGGCCAGAGGACTGGGAGGG + Intronic
979829438 4:125281386-125281408 GTGTGGCCAGAGGCCCTGGCGGG + Intergenic
980333589 4:131440708-131440730 GAGTGGCCAGATGCCCTGGCTGG + Intergenic
981327963 4:143473811-143473833 GAGTTGCAAGTGGGCTGGGTGGG - Exonic
983898613 4:173108396-173108418 TAGTGGCCAGTGGACAGGGTGGG + Intergenic
984740281 4:183154861-183154883 GAGGGGCCAGAGTCCAGGTTAGG - Intronic
984945923 4:184968853-184968875 GAGTGGCCACACCCCTGGGCAGG + Intergenic
985345710 4:189002144-189002166 GGGTGGCCAGAGGCCCTGGCTGG + Intergenic
985393034 4:189512027-189512049 GAGTGGCGAGCGACCTGGTTAGG - Intergenic
985652778 5:1114641-1114663 GAGGTACCCGAGGCCTGGGTTGG + Intergenic
985672801 5:1214842-1214864 GACTGGACGGGGGCCTGGGTAGG + Intronic
985882031 5:2645664-2645686 GAGTGACCAGTGGCTTGGGTTGG + Intergenic
986253694 5:6083772-6083794 GAGGGGCAGGAGGCCAGGGTGGG - Intergenic
986347334 5:6846944-6846966 AAGAGGCCAGAGGCCCGGATGGG + Intergenic
986929000 5:12795084-12795106 GAGTGGCCAGTGGCCTTCGGGGG - Intergenic
987561822 5:19533697-19533719 GAGTGGCCAGAGACTTGGCATGG + Intronic
987906785 5:24088209-24088231 GAGTGGCCAGAGGCCTGGGTGGG - Intronic
988798380 5:34673753-34673775 GAGGGGACAGAGGCAGGGGTGGG - Intronic
989159350 5:38375496-38375518 GAGTGGCCTGTGTCCTTGGTGGG - Intronic
991377811 5:65984491-65984513 AGGGTGCCAGAGGCCTGGGTGGG - Intronic
992618703 5:78571398-78571420 GAGAGGGCAGAGGCGAGGGTGGG - Intronic
994096909 5:95855407-95855429 AAGTGGCTAGAGGCCTGCGTGGG - Intronic
995652232 5:114382788-114382810 GAGTGGCCAGTTTCCAGGGTTGG - Intronic
995736691 5:115308482-115308504 GAGGGGGCAGATCCCTGGGTGGG + Intergenic
997386895 5:133480688-133480710 GACTGCCCAGAGGCCTCGCTGGG - Intronic
997981454 5:138470104-138470126 GAGTGGGCAGAAGCCTGGCCTGG + Intergenic
999723007 5:154412639-154412661 GAGTATGCAGAGTCCTGGGTTGG - Intronic
1000017569 5:157291344-157291366 CAGTGGAAAGAGCCCTGGGTGGG - Intronic
1001281277 5:170388070-170388092 GAGTGCCCAGGGGCCTGAGAGGG - Intronic
1001700862 5:173705683-173705705 GAGTGGCCGGAGCCCAGGGCTGG + Intergenic
1001857703 5:175027091-175027113 AATTGGCCAGAGGCCAGGGGAGG + Intergenic
1002046797 5:176546010-176546032 GAGGGGGCAGGGGCTTGGGTTGG + Intronic
1002131731 5:177086557-177086579 GCCTGGCCTGGGGCCTGGGTGGG + Intergenic
1002171131 5:177375134-177375156 GTGTGGCCAGAGGTTGGGGTAGG + Intergenic
1002173107 5:177386175-177386197 TAGTGGGCAGAGGCCAGGGCAGG - Intronic
1002297755 5:178240746-178240768 CAGAGGCCAGAGGTCTGGGAGGG + Intronic
1002476307 5:179468509-179468531 GAGTGGGCAGTGGCCTCGGGTGG - Intergenic
1004168790 6:13279652-13279674 GAATGGCCAGACGACTGGCTGGG + Intronic
1007105677 6:39281465-39281487 CAGTGACCAAAGGGCTGGGTGGG - Intergenic
1007931021 6:45690590-45690612 GAGTGGACAGAGGCTTGTGGGGG + Intergenic
1008581778 6:52914426-52914448 GAGTTGCCTGAGGGGTGGGTAGG - Intergenic
1010008459 6:71022895-71022917 AAGTGACCAGATGCCTGGGATGG - Intergenic
1011947068 6:92918909-92918931 GAGGGGCCTGGGGACTGGGTTGG - Intergenic
1012474885 6:99607388-99607410 GAGAGGCGACAGCCCTGGGTGGG + Intronic
1013009703 6:106108329-106108351 GAATGGCCACAGGACTCGGTGGG - Exonic
1013770994 6:113628159-113628181 TAGTGGCCTGAGGCCTCGGAGGG + Intergenic
1016996944 6:149967407-149967429 GAGAGCCCAGAGGCCCTGGTGGG - Intronic
1017001865 6:150002845-150002867 GAGAGCCCAGAGGCCCTGGTGGG + Intergenic
1017005368 6:150025130-150025152 GAGGGGCCAGAGGGCTGCGAGGG - Intronic
1017686098 6:156914753-156914775 GGGTGGCCAGAGGCCCGCTTTGG - Intronic
1017827378 6:158091929-158091951 GACTGGAAGGAGGCCTGGGTGGG + Intronic
1018128724 6:160707275-160707297 GAGGGGTCAGGGGCCAGGGTGGG + Intronic
1018764803 6:166925047-166925069 GACTGGGTAGAGGCCTGGGTGGG - Intronic
1018779324 6:167047353-167047375 CAGTGGCTAGAAGCCTGGATGGG + Exonic
1018931348 6:168242239-168242261 GAGTGGGCATGGGGCTGGGTGGG + Intergenic
1019010247 6:168839212-168839234 CAGAGGGCAGAGGCCTGGGGCGG + Intergenic
1019055778 6:169222288-169222310 GAGTAGCCATAGGCCCGCGTGGG + Exonic
1019301431 7:306027-306049 GAGAGGGCAGAGGCCCGGGCTGG - Intergenic
1019340421 7:506447-506469 GAGTGGACAGAGTCGTGGCTGGG + Intronic
1019455409 7:1124291-1124313 CAGTGACCAGCGGCCTGTGTGGG + Intronic
1019523119 7:1469361-1469383 GAGTGCCCAGGGGCCCGGGCAGG + Intergenic
1019701175 7:2475649-2475671 GAGGTGACAGGGGCCTGGGTGGG - Exonic
1020006238 7:4785057-4785079 GGGAGGCCAGTGCCCTGGGTGGG - Intronic
1020913833 7:14167246-14167268 GAATTGCCAGAGGACTGGGATGG - Intronic
1023340034 7:39210346-39210368 GACAGGCTAGAGGGCTGGGTAGG - Intronic
1023623451 7:42094951-42094973 CAGTGGGCAGAGGACTAGGTAGG + Intronic
1024046542 7:45589359-45589381 GAGTGGCCAGCGGGCTGTGGTGG + Intronic
1025098534 7:56116315-56116337 CGGTGGCCACAGGCCTGGGCAGG - Exonic
1025528426 7:61844412-61844434 GAGTGCACTGAGGCCTGTGTTGG - Intergenic
1025870028 7:65422747-65422769 GAGTGGCTGGAGGCCCTGGTTGG - Intergenic
1026226035 7:68441941-68441963 GAGTGGACAGAGCCATGTGTGGG + Intergenic
1027190057 7:75991308-75991330 TAGTGGCCAGAGGTCGGGGCGGG - Intronic
1029424844 7:100488952-100488974 GGCTGGCCAGAGCCCTGGGGTGG - Exonic
1029438761 7:100576196-100576218 GCGTGGGCAGGGGCCTGGGCCGG - Intronic
1030696243 7:112588331-112588353 GGGTGGCCAGAGGCCATGGCTGG - Intergenic
1031627252 7:124005111-124005133 GGGTGGCTAGAGGCCCTGGTTGG + Intergenic
1033447437 7:141435660-141435682 GTGAGGCCAGCGGCCTGCGTGGG - Intronic
1033843014 7:145398127-145398149 GATTTGCCAGATGCCTGGATTGG + Intergenic
1034218087 7:149422980-149423002 GATGGGCCAGAGGCCTGGCTTGG + Intergenic
1034364461 7:150534329-150534351 GGGTGGCTAGAGGCCCTGGTTGG + Intergenic
1035118552 7:156545544-156545566 GCATGTCCAGAGGCCTGAGTAGG - Intergenic
1035225700 7:157430984-157431006 GAGTGGCCAGAGCCCGGGGTGGG + Intergenic
1035287611 7:157816292-157816314 GTGTGGTCGGGGGCCTGGGTCGG + Intronic
1036038975 8:5053119-5053141 GAATGGCCAAAGCTCTGGGTTGG - Intergenic
1036609792 8:10339934-10339956 GGGAGAGCAGAGGCCTGGGTGGG - Intronic
1038151051 8:24942468-24942490 CAGTGGCCAGAGGACTGAGTGGG - Intergenic
1038309885 8:26438340-26438362 GAGTTGCCAGAGGCTGGGGAAGG + Intronic
1038492355 8:27980363-27980385 GTGAGGACAGAGCCCTGGGTGGG - Intronic
1040016719 8:42706236-42706258 GACTGGCCCGAGGGCTGGGGAGG + Intronic
1040783270 8:51136985-51137007 GAGTTGCCAGACGCCTGTGGTGG + Intergenic
1041623448 8:59999511-59999533 GAGTGGCTGGAGGCCCTGGTTGG - Intergenic
1041808953 8:61886814-61886836 GACTGGCCTGTGGCCTGGGCTGG + Intergenic
1042269735 8:66942775-66942797 GAGTAGCCACAAGTCTGGGTGGG + Intergenic
1042400209 8:68336331-68336353 GAGTGGGCAGTGGCCTGGCAGGG + Intronic
1044938426 8:97315662-97315684 AAGTGGGAAGAGCCCTGGGTAGG - Intergenic
1047420966 8:124707928-124707950 AACTGGCCAGTGGCCTGGGCAGG + Intronic
1048031848 8:130640695-130640717 CAGAGGCCTGGGGCCTGGGTCGG - Intergenic
1048239712 8:132729496-132729518 GAGTAGCCAGAGTCCTGCTTTGG + Intronic
1048275024 8:133059428-133059450 AACTGGTCAGAGGCCTGGGAGGG - Intronic
1048889710 8:138936386-138936408 AAGGGGCCAGAGCCCTGGGCAGG - Intergenic
1049098482 8:140562738-140562760 GGTTGGCTAGAGGCCTGGGCGGG - Intronic
1049103487 8:140596803-140596825 GAGAGGCAAGTGGCCGGGGTGGG + Intronic
1049217532 8:141415013-141415035 GGGTGGCGGGGGGCCTGGGTGGG + Intronic
1049562229 8:143317548-143317570 AGGTGGCCAGAGTCCTGGGGAGG - Intronic
1049639959 8:143711084-143711106 GGCTGGGCAGAGGCCTGGGGGGG - Intronic
1049696199 8:143985436-143985458 CAGTGCCCAGGGGCCCGGGTAGG + Exonic
1049849039 8:144820985-144821007 GAGTGGCCACAGGCCTGCTGCGG - Intergenic
1050580713 9:7052837-7052859 GTGTGGCCAGAGCTCTGGTTAGG - Intronic
1052176724 9:25472089-25472111 GAGTGACCAGAGGCCCTGGCTGG + Intergenic
1053148851 9:35730347-35730369 GTGTGGTCAGTGGCCTGGCTGGG + Intronic
1053385733 9:37686271-37686293 GAGTGGCCAGAGGGCAGCATTGG + Intronic
1055788932 9:79900649-79900671 GACTGGTCCGAGGGCTGGGTGGG - Intergenic
1057211520 9:93203299-93203321 GAGTGGACAGTGGTCTGAGTTGG + Intronic
1057565007 9:96159920-96159942 TAGTGGCCAGAGGCCCTGGAGGG - Intergenic
1057590376 9:96367945-96367967 GAGTTGGCTGAGGACTGGGTGGG - Intronic
1057908073 9:98997704-98997726 CAGGGGCCAGAGCCCTGGATGGG - Intronic
1058516836 9:105784502-105784524 AAATGGCCAAAGGACTGGGTTGG - Intergenic
1058524148 9:105840337-105840359 ATGTGGACAGAGGACTGGGTAGG + Intergenic
1058674605 9:107389666-107389688 CAGTGGCCAAAGGGCAGGGTTGG - Intergenic
1058799004 9:108526726-108526748 GAGAGGCCAGAGCCATGAGTGGG - Intergenic
1058826481 9:108779608-108779630 GAGTGGGCAGAGGAGTGGGCTGG + Intergenic
1059061034 9:111036170-111036192 GAGTGCCCACAGACCTGGGCAGG + Intronic
1059306459 9:113356958-113356980 GAGTTGGGAGAGGGCTGGGTTGG + Intronic
1060251177 9:121987882-121987904 CAGGAGACAGAGGCCTGGGTTGG - Intronic
1060744283 9:126120056-126120078 GAGAGGCCAAAGGACTGGCTGGG - Intergenic
1060814652 9:126628196-126628218 GGGAGGCCAGAGGCCTGGCTGGG + Intronic
1060975417 9:127762240-127762262 GAGAGGCCAGAGGCCAGAGACGG + Intronic
1061062887 9:128259477-128259499 AAGGGGCCAGAGGTCTGGGCAGG - Intronic
1061090458 9:128423065-128423087 CAGTGGACAGAGCCCTGGCTTGG - Intronic
1061304750 9:129725761-129725783 CACTGGCCAGGGGCCTGGGTTGG - Intergenic
1061629540 9:131863423-131863445 GAGCGGCCAGAGGCCAGTGGGGG + Intronic
1061690157 9:132321114-132321136 GTGTGGGAAGAGGGCTGGGTAGG - Intronic
1061910069 9:133717660-133717682 GAGTGGGTGGAGGCCTGGGCTGG - Intronic
1062362323 9:136193783-136193805 GAGGGGCCGGAGGCCGGGGCGGG + Intergenic
1062565300 9:137161592-137161614 GCGGGGCCTGAGGGCTGGGTGGG + Intronic
1186442954 X:9601618-9601640 GAGTGGCCAGAGGGGTGGGAAGG - Intronic
1188248231 X:27859442-27859464 AAGTGGCCTCAGGCCTGAGTGGG - Intergenic
1188727851 X:33607335-33607357 GAGTGGGGAGAGGCCAGGGAGGG + Intergenic
1188901054 X:35733690-35733712 GGGTGGCCAGAGGCCCTGGCTGG + Intergenic
1189281082 X:39820671-39820693 GGGTGCCAGGAGGCCTGGGTGGG - Intergenic
1189705329 X:43753992-43754014 GAGTGACCAGAGACGAGGGTAGG - Intergenic
1190318278 X:49164932-49164954 AAATGACCAGAGGCCTGGGATGG - Exonic
1190730225 X:53221008-53221030 GAGTGGCTAGAGGTTTGGGAAGG - Intronic
1192779689 X:74281677-74281699 AAGTGGCCAGTGGCTTTGGTGGG - Intergenic
1192891727 X:75398391-75398413 GGGTGGCCGGAGGCCCTGGTTGG - Intronic
1195105175 X:101596556-101596578 AAGTGGCAGGAGGCCAGGGTGGG + Intergenic
1196582008 X:117390865-117390887 GGGTGGCTAGAGGCCCCGGTTGG - Intergenic
1196910454 X:120479509-120479531 GAGAGTCTAAAGGCCTGGGTGGG + Intergenic
1198291562 X:135245698-135245720 GGCTGGCCAGGGGCTTGGGTGGG - Intergenic
1199855108 X:151753427-151753449 GCTGGGCAAGAGGCCTGGGTGGG + Intergenic
1199932123 X:152533979-152534001 GTGGGGCGAGAGGCATGGGTTGG - Intergenic
1200127229 X:153821557-153821579 GAGTAGCCAGGGCCTTGGGTAGG - Intronic
1201018202 Y:9625532-9625554 GAGCCGCCAGATGACTGGGTGGG - Intergenic
1201466774 Y:14290277-14290299 TAGTGGGCAAAGGCCTGGGGTGG + Intergenic