ID: 987910908

View in Genome Browser
Species Human (GRCh38)
Location 5:24144071-24144093
Sequence TTGTTTTTCTTTGGTAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987910906_987910908 0 Left 987910906 5:24144048-24144070 CCAAATGTCATAAAATTCAGACA 0: 1
1: 0
2: 1
3: 26
4: 329
Right 987910908 5:24144071-24144093 TTGTTTTTCTTTGGTAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987910908 Original CRISPR TTGTTTTTCTTTGGTAAAAC AGG Intronic
No off target data available for this crispr