ID: 987911300

View in Genome Browser
Species Human (GRCh38)
Location 5:24149697-24149719
Sequence TTGGTCACCCAGCACTATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 89}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987911300 Original CRISPR TTGGTCACCCAGCACTATCA TGG (reversed) Intronic
904373317 1:30064621-30064643 AAGGTCACACAGCACTTTCATGG - Intergenic
905495708 1:38384161-38384183 GTGGTTACCCAACAGTATCAAGG - Intergenic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
916151504 1:161796701-161796723 CTGGTCACCCAAAACCATCAAGG - Intronic
920229248 1:204459787-204459809 GGGATCACCCAGCACTATGAGGG - Intronic
1063424208 10:5938730-5938752 GTGTTTAACCAGCACTATCAAGG + Intronic
1072166461 10:92818050-92818072 GTGGTCACCTAGCATTTTCATGG + Intergenic
1073006564 10:100329708-100329730 TGGGTCATGCAGCACTACCATGG + Intronic
1082044825 11:47716318-47716340 TTGATCACACAGCACCATCTGGG + Intergenic
1082224635 11:49689999-49690021 TTGGTCAGCCTGCACTCCCATGG - Intergenic
1083631048 11:64095744-64095766 CTGGACCCCCAGCACTAGCACGG + Intronic
1086452920 11:86934749-86934771 TTGATTACCCACCACTATCTTGG - Intronic
1086624410 11:88929180-88929202 TTGGTCAGCCTGCACTCCCATGG + Intronic
1089064233 11:115650262-115650284 TTGGTTTCCCAGCATTCTCAGGG + Intergenic
1089116959 11:116103168-116103190 CTGGTCACCCAGAGCTTTCAGGG - Intergenic
1090400318 11:126444711-126444733 TTCATCACCCACCACTCTCAGGG + Intronic
1093147368 12:15582356-15582378 TTGGTCTCCCAGCACTTCCCTGG - Intronic
1101119274 12:101562299-101562321 TCTTTCACCCAGCACAATCATGG + Intergenic
1107636447 13:42396805-42396827 TTGGTCAACCAGCATAATCCTGG - Intergenic
1114725120 14:24928241-24928263 TGGCTCCCCCAGCACTACCATGG + Intronic
1114850637 14:26378864-26378886 TTGGTCATTTAGCACTATCTTGG + Intergenic
1118252905 14:64179847-64179869 TTGTTCAGCCAGCAATACCAAGG - Intronic
1122310103 14:100788954-100788976 CTGGTCTCCCAGCACCATCACGG - Intergenic
1123630533 15:22257538-22257560 TTGGGGACCCGGCACAATCACGG + Intergenic
1127363453 15:58265143-58265165 TTTGTAACCCAGCATTAACATGG + Intronic
1128125461 15:65189165-65189187 TTGGTCACCCTACAATACCAAGG - Intergenic
1134821416 16:17250585-17250607 TTGGTCAGCCACCACATTCAAGG - Intronic
1140720008 16:77763219-77763241 TTGGTCCCACAGCACTTTTATGG + Intergenic
1141115803 16:81308167-81308189 TTGTACACCCAGCAGTATCCTGG + Intergenic
1141537151 16:84689982-84690004 TAGTTCACCCAGCACTTCCAAGG - Intergenic
1141972557 16:87493111-87493133 TTGGGGACCCGGCACAATCACGG - Intergenic
1150067706 17:62125392-62125414 GTGGTCACCCACCTCTGTCAAGG - Intergenic
1150305699 17:64083652-64083674 TTGGTCTCCCAGGATTAACACGG + Intronic
1153199625 18:2635051-2635073 TTGGTCTCCCAGCATTTTGATGG - Intergenic
1153709563 18:7784048-7784070 TAGGTCACACAGAACTTTCAAGG - Intronic
1157286623 18:46381434-46381456 TTGCTCACCCAGTGCTCTCAGGG + Intronic
1158424390 18:57326049-57326071 TTTGTCTCCCAGCTTTATCAAGG + Intergenic
1158504859 18:58038195-58038217 TTGGCCACACAGCAGCATCAGGG - Intergenic
1161029663 19:2051743-2051765 CTGGTCCCCCAGCACTAGAAGGG - Intergenic
1166204090 19:41257733-41257755 TGGGTCACTCAGCATTCTCAGGG - Intronic
928323601 2:30302769-30302791 TTGGTCACCTATCTCTATTAGGG - Intronic
928459708 2:31459060-31459082 TTTGTGACCCAACACTCTCAAGG - Intergenic
932592714 2:73076660-73076682 TTGGTCAACCAGCTCTCTCTAGG + Intronic
937378129 2:121351929-121351951 TTGTTCACCCAGCACTGACCAGG + Intronic
938030073 2:127984765-127984787 AGGGTCACCCAGCACTATAGAGG - Intronic
945695364 2:213095385-213095407 TTGGTCAACCACCAGTATGATGG - Intronic
1169413889 20:5399211-5399233 TTGGTCATCCATCACTCTCTAGG + Intergenic
1172768237 20:37362544-37362566 TTGGTCACACAGCAAGACCAAGG - Intronic
1172810021 20:37640807-37640829 CTGGTCACACAGCACATTCATGG - Intergenic
1184026573 22:41862017-41862039 TTTGTTACCCAGCCCTATTAGGG - Intronic
1184676420 22:46045565-46045587 ATGGTCACCCAGGACGGTCAAGG - Intergenic
1185179258 22:49349856-49349878 TTGGTCAGCCACCACTGCCAGGG + Intergenic
953201979 3:40786027-40786049 ATGGTCACCAATGACTATCAAGG - Intergenic
954390119 3:50264340-50264362 TTGGGCACCCAGGCCTATGAGGG - Intergenic
960974145 3:123159166-123159188 ATGTTCATCCAGCACTTTCATGG + Intronic
961500190 3:127326879-127326901 TGGCCCACCCAGCACTGTCATGG + Intergenic
962874926 3:139528548-139528570 TTGGTCACCCAGCAAGAACAAGG - Intronic
969137500 4:5042541-5042563 TTGGTCACCTAACACTGACACGG - Intergenic
970124407 4:12792957-12792979 TTGGTCTACCAGGACTATCTTGG - Intergenic
971633751 4:29030737-29030759 TTGTTAACACAGCTCTATCATGG + Intergenic
975327536 4:73077029-73077051 TGGGTCCTCCAGCACCATCAGGG + Exonic
980159808 4:129146831-129146853 ATGATCCCCCAGCACCATCAGGG + Intergenic
980346195 4:131623198-131623220 TTATTCTCCCATCACTATCAAGG + Intergenic
982766025 4:159349533-159349555 TTTGTGACACAGCACTTTCATGG + Intronic
985495954 5:206137-206159 TTGGTCACCCAGCCCTTACCTGG - Intronic
985761121 5:1749423-1749445 TTGGTGACCCAGCTTTGTCAAGG - Intergenic
986020048 5:3793186-3793208 TTGCTCACCCGGCACATTCAGGG - Intergenic
987243857 5:16028568-16028590 TGTGTCACACAGCACTGTCAAGG - Intergenic
987350134 5:17014913-17014935 TTAGTCAACCAGCATTGTCATGG - Intergenic
987911300 5:24149697-24149719 TTGGTCACCCAGCACTATCATGG - Intronic
995046915 5:107660877-107660899 TTAGTGACCCAGCACTAAGAGGG - Intronic
996625678 5:125567932-125567954 TTGGTCACCAGGCACTATGTTGG + Intergenic
997241756 5:132312814-132312836 CTGGTCACCCAGCACATACAGGG - Intronic
1008308339 6:49933753-49933775 TTGGTGGCCCCGCACTAGCAGGG + Intergenic
1008689559 6:53962488-53962510 TTGGTGACCCAGCAGTGGCAAGG - Intronic
1010685610 6:78851765-78851787 TTGTTCACTCAGAAATATCAGGG - Intergenic
1015509293 6:134022085-134022107 TATCTCACCCAGCTCTATCAGGG - Intronic
1021430577 7:20554246-20554268 TCAGTGACTCAGCACTATCAAGG + Intergenic
1024862223 7:53857985-53858007 TTCCTCTCCCAGCACTTTCAAGG + Intergenic
1027240586 7:76325414-76325436 TTTGTCACCCAGAACTACCCTGG - Intergenic
1027423856 7:78042541-78042563 TTGGTCAGGGAGCACGATCAAGG - Intronic
1029935424 7:104419886-104419908 TTGGGCACCCAGAAGTATCCCGG + Intronic
1030227951 7:107172964-107172986 TTGGTCACTTACCACTTTCATGG - Intronic
1031941495 7:127794046-127794068 TTTATCACCCACTACTATCATGG - Intronic
1046135621 8:110022791-110022813 GTTTTCACCCAGCACTAACAAGG - Intergenic
1050366208 9:4876090-4876112 TTAGTGGCCCAGAACTATCAAGG - Intronic
1058689959 9:107511545-107511567 CTGGTCACACAGCACTAAGAGGG - Intergenic
1059976674 9:119725088-119725110 TTGCTCACCCCACACTATCAAGG + Intergenic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1189772626 X:44441641-44441663 AGGGTCTCCCAGCACCATCAAGG - Intergenic
1189772944 X:44444323-44444345 AGGGTCTCCCAGCACCATCAAGG - Intergenic
1194178150 X:90677593-90677615 TTTGTTACCCAGCAATATCATGG - Intergenic
1195975118 X:110518400-110518422 TTAGTCACCTAGCTATATCAGGG + Intergenic
1199464624 X:148122264-148122286 TTGGTCACCCATCCTTAACAGGG + Intergenic
1200524812 Y:4259741-4259763 TTTGTTACCCAGCAATATCATGG - Intergenic