ID: 987917211

View in Genome Browser
Species Human (GRCh38)
Location 5:24229220-24229242
Sequence GAGGGAAAGAGACTGCCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987917211_987917216 22 Left 987917211 5:24229220-24229242 CCTGAAGGCAGTCTCTTTCCCTC No data
Right 987917216 5:24229265-24229287 TTTCCACCTGGCTCACCATGTGG No data
987917211_987917220 30 Left 987917211 5:24229220-24229242 CCTGAAGGCAGTCTCTTTCCCTC No data
Right 987917220 5:24229273-24229295 TGGCTCACCATGTGGGCTGCAGG No data
987917211_987917212 -10 Left 987917211 5:24229220-24229242 CCTGAAGGCAGTCTCTTTCCCTC No data
Right 987917212 5:24229233-24229255 TCTTTCCCTCTCACACTCTGAGG No data
987917211_987917215 10 Left 987917211 5:24229220-24229242 CCTGAAGGCAGTCTCTTTCCCTC No data
Right 987917215 5:24229253-24229275 AGGATTTAGAGTTTTCCACCTGG No data
987917211_987917217 23 Left 987917211 5:24229220-24229242 CCTGAAGGCAGTCTCTTTCCCTC No data
Right 987917217 5:24229266-24229288 TTCCACCTGGCTCACCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987917211 Original CRISPR GAGGGAAAGAGACTGCCTTC AGG (reversed) Intergenic
No off target data available for this crispr