ID: 987917213

View in Genome Browser
Species Human (GRCh38)
Location 5:24229238-24229260
Sequence TAAATCCTCAGAGTGTGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987917213_987917216 4 Left 987917213 5:24229238-24229260 CCCTCTCACACTCTGAGGATTTA No data
Right 987917216 5:24229265-24229287 TTTCCACCTGGCTCACCATGTGG No data
987917213_987917215 -8 Left 987917213 5:24229238-24229260 CCCTCTCACACTCTGAGGATTTA No data
Right 987917215 5:24229253-24229275 AGGATTTAGAGTTTTCCACCTGG No data
987917213_987917220 12 Left 987917213 5:24229238-24229260 CCCTCTCACACTCTGAGGATTTA No data
Right 987917220 5:24229273-24229295 TGGCTCACCATGTGGGCTGCAGG No data
987917213_987917217 5 Left 987917213 5:24229238-24229260 CCCTCTCACACTCTGAGGATTTA No data
Right 987917217 5:24229266-24229288 TTCCACCTGGCTCACCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987917213 Original CRISPR TAAATCCTCAGAGTGTGAGA GGG (reversed) Intergenic
No off target data available for this crispr