ID: 987917217

View in Genome Browser
Species Human (GRCh38)
Location 5:24229266-24229288
Sequence TTCCACCTGGCTCACCATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987917213_987917217 5 Left 987917213 5:24229238-24229260 CCCTCTCACACTCTGAGGATTTA No data
Right 987917217 5:24229266-24229288 TTCCACCTGGCTCACCATGTGGG No data
987917214_987917217 4 Left 987917214 5:24229239-24229261 CCTCTCACACTCTGAGGATTTAG No data
Right 987917217 5:24229266-24229288 TTCCACCTGGCTCACCATGTGGG No data
987917211_987917217 23 Left 987917211 5:24229220-24229242 CCTGAAGGCAGTCTCTTTCCCTC No data
Right 987917217 5:24229266-24229288 TTCCACCTGGCTCACCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987917217 Original CRISPR TTCCACCTGGCTCACCATGT GGG Intergenic
No off target data available for this crispr