ID: 987918647

View in Genome Browser
Species Human (GRCh38)
Location 5:24249435-24249457
Sequence CAAAATGCTGACAGTGACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987918647_987918652 5 Left 987918647 5:24249435-24249457 CCCATGTCACTGTCAGCATTTTG No data
Right 987918652 5:24249463-24249485 AACAATTCAACAGGTCTCCAGGG No data
987918647_987918650 -4 Left 987918647 5:24249435-24249457 CCCATGTCACTGTCAGCATTTTG No data
Right 987918650 5:24249454-24249476 TTTGGTCACAACAATTCAACAGG No data
987918647_987918651 4 Left 987918647 5:24249435-24249457 CCCATGTCACTGTCAGCATTTTG No data
Right 987918651 5:24249462-24249484 CAACAATTCAACAGGTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987918647 Original CRISPR CAAAATGCTGACAGTGACAT GGG (reversed) Intergenic
No off target data available for this crispr