ID: 987918651

View in Genome Browser
Species Human (GRCh38)
Location 5:24249462-24249484
Sequence CAACAATTCAACAGGTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987918646_987918651 18 Left 987918646 5:24249421-24249443 CCTGGACTTCACTGCCCATGTCA No data
Right 987918651 5:24249462-24249484 CAACAATTCAACAGGTCTCCAGG No data
987918648_987918651 3 Left 987918648 5:24249436-24249458 CCATGTCACTGTCAGCATTTTGG 0: 13
1: 165
2: 1201
3: 1743
4: 1713
Right 987918651 5:24249462-24249484 CAACAATTCAACAGGTCTCCAGG No data
987918647_987918651 4 Left 987918647 5:24249435-24249457 CCCATGTCACTGTCAGCATTTTG No data
Right 987918651 5:24249462-24249484 CAACAATTCAACAGGTCTCCAGG No data
987918645_987918651 24 Left 987918645 5:24249415-24249437 CCTCAGCCTGGACTTCACTGCCC No data
Right 987918651 5:24249462-24249484 CAACAATTCAACAGGTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987918651 Original CRISPR CAACAATTCAACAGGTCTCC AGG Intergenic
No off target data available for this crispr