ID: 987919660

View in Genome Browser
Species Human (GRCh38)
Location 5:24263050-24263072
Sequence TATCACCCTATTCCAAATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987919660_987919661 13 Left 987919660 5:24263050-24263072 CCATTATTTGGAATAGGGTGATA No data
Right 987919661 5:24263086-24263108 CATTTTTTCCCTCTAATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987919660 Original CRISPR TATCACCCTATTCCAAATAA TGG (reversed) Intergenic
No off target data available for this crispr