ID: 987921708

View in Genome Browser
Species Human (GRCh38)
Location 5:24291897-24291919
Sequence CCTTATTTCTGCAGTTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987921703_987921708 29 Left 987921703 5:24291845-24291867 CCAAAAAGATTGTGTCATATATT No data
Right 987921708 5:24291897-24291919 CCTTATTTCTGCAGTTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987921708 Original CRISPR CCTTATTTCTGCAGTTGGGG TGG Intergenic
No off target data available for this crispr